Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF01541 gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -206
Score: 6.55074
Sequence: AGTTTAGAACAATTCGAAACT
Locus tag: RHE_CH02254
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: RHE_CH02253
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RHE_CH02252
Name: PF01541
Funciton: Excinuclease ABC, C subunit-like
Locus tag: RHE_CH02251
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: RHE_CH02250
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RHE_CH02249
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: RHE_CH02248
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: RHE_CH02247
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-PF01541-sufC-sufD-sufS1-PF01883-sufA -206 6.6 AGTTTAGAACAATTCGAAACT RHE_CH02254
© 2009-2020 RegPrecise