Orthologous regulated operons containing PF00903 gene

Properties
Regulog:	Irr - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Phylum:	Proteobacteria/alpha

Built upon 122 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -99 Score: 5.96998 Sequence: TATTTAGAATAATTCTAATGT Locus tag: AZC_3616 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: AZC_3615 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: AZC_3614 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: AZC_3613 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: AZC_3612 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: AZC_3611 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly Locus tag: AZC_3610 Name: PF00903 Funciton: putative lactoylglutathione lyase Locus tag: AZC_3609 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-PF00903-sufA	-99	6	TATTTAGAATAATTCTAATGT	AZC_3616
Xanthobacter autotrophicus Py2
Position: -158 Score: 6.03007 Sequence: GATTTAGAATAATTCTAATCT Locus tag: Xaut_4470 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Xaut_4469 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: Xaut_4468 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: Xaut_4467 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: Xaut_4466 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: Xaut_4465 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly Locus tag: Xaut_4464 Name: PF00903 Funciton: putative lactoylglutathione lyase
sufS2-sufB-sufC-sufD-sufS1-PF01883-PF00903	-158	6	GATTTAGAATAATTCTAATCT	Xaut_4470