Orthologous regulated operons containing znuC3 gene

Properties
Regulog:	Zur - Rhodospirillales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 27 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azospirillum sp. B510
Position: -129 Score: 5.30077 Sequence: GTCACGTTATAACGTAACATGTC Locus tag: AZL_d00760 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: AZL_d00750 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC3-znuB3	-129	5.3	GTCACGTTATAACGTAACATGTC	AZL_d00760
Magnetospirillum magneticum AMB-1
Position: -36 Score: 6.42378 Sequence: GGAATGTTATAATATAACAAATC Locus tag: amb2309 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: amb2310 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: amb2311 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC3-znuB3	-36	6.4	GGAATGTTATAATATAACAAATC	amb2309
Magnetospirillum magnetotacticum MS-1
Position: -87 Score: 6.90199 Sequence: GAAATGTTATAATATAACATATC Locus tag: Magn03007851 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Magn03007852 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: Magn03007853 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC3-znuB3	-87	6.9	GAAATGTTATAATATAACATATC	Magn03007851
Rhodospirillum centenum SW
Position: -75 Score: 5.7965 Sequence: AGATCGTTATATTATAACATTTG Locus tag: RC1_3160 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: RC1_3159 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC3-znuB3	-75	5.8	AGATCGTTATATTATAACATTTG	RC1_3160