Orthologous regulated operons containing manZ gene

Properties
Regulog:	NagC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor (activator)
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 68 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -139 Score: 5.44708 Sequence: TTTTTTTCGCTATCTAAAATAAT Locus tag: CKO_01161 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: CKO_01160 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: CKO_01159 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-139	5.4	TTTTTTTCGCTATCTAAAATAAT	CKO_01161
Edwardsiella tarda EIB202
Position: -242 Score: 5.08753 Sequence: TTTTTTTTACTGACTAAAATAAA Locus tag: ETAE_1559 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: ETAE_1558 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: ETAE_1557 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-242	5.1	TTTTTTTTACTGACTAAAATAAA	ETAE_1559
Enterobacter sp. 638
Position: -141 Score: 5.22005 Sequence: ATTTTTTCACTGTCTAAAATAAT Locus tag: Ent638_2386 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: Ent638_2387 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: Ent638_2388 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-141	5.2	ATTTTTTCACTGTCTAAAATAAT	Ent638_2386
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -203 Score: 5.38983 Sequence: ATTTTTTCGATAAGTAAAATAAA Locus tag: ECA2385 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: ECA2386 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: ECA2387 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-203	5.4	ATTTTTTCGATAAGTAAAATAAA	ECA2385
Escherichia coli str. K-12 substr. MG1655
Position: -140 Score: 5.19076 Sequence: ATTTTTTCGATATCTAAAATAAA Locus tag: b1817 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: b1818 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: b1819 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-140	5.2	ATTTTTTCGATATCTAAAATAAA	b1817
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -203 Score: 5.00222 Sequence: TATTTTTTGCGCTGCAAAATTAT Position: -138 Score: 5.22005 Sequence: ATTTTTTCACTGTCTAAAATAAT Locus tag: KPN_02333 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: KPN_02334 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: KPN_02335 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-203	5	TATTTTTTGCGCTGCAAAATTAT	KPN_02333
	-138	5.2	ATTTTTTCACTGTCTAAAATAAT
Salmonella typhimurium LT2
Position: -141 Score: 5.19076 Sequence: TTTTTTTCGATATCTAAAATAAT Locus tag: STM1830 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: STM1831 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: STM1832 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-141	5.2	TTTTTTTCGATATCTAAAATAAT	STM1830
Serratia proteamaculans 568
Position: -195 Score: 5.12982 Sequence: ATTTTTTCACTCACTAAAATAAA Locus tag: Spro_2813 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: Spro_2814 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: Spro_2815 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-195	5.1	ATTTTTTCACTCACTAAAATAAA	Spro_2813
Yersinia pestis KIM
Position: -206 Score: 5.12982 Sequence: ATTTTTTCACTGACTAAAATAAA Locus tag: y2551 Name: manX Funciton: PTS system, mannose-specific IIAB component Locus tag: y2552 Name: manY Funciton: PTS system, mannose-specific IIc component Locus tag: y2553 Name: manZ Funciton: PTS system, mannose-specific IID component
manX-manY-manZ	-206	5.1	ATTTTTTCACTGACTAAAATAAA	y2551

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing manZ gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --