Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ccmG gene

Properties
Regulog: ModE - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Built upon 55 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -221
Score: 5.74115
Sequence: CGCTATATAAATATATTTATAACC
Locus tag: b2208
Name: napF
Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
Locus tag: b2207
Name: napD
Funciton: NapD family protein
Locus tag: b2206
Name: napA
Funciton: nitrate reductase, periplasmic, large subunit
Locus tag: b2205
Name: napG
Funciton: quinol dehydrogenase periplasmic component
Locus tag: b2204
Name: napH
Funciton: quinol dehydrogenase membrane component
Locus tag: b2203
Name: napB
Funciton: cytochrome c-type protein
Locus tag: b2202
Name: napC
Funciton: nitrate reductase, cytochrome c-type, periplasmic
Locus tag: b2201
Name: ccmA
Funciton: ATP binding protein of heme exporter A
Locus tag: b2200
Name: ccmB
Funciton: heme exporter protein B (cytochrome C-type biogenesis protein)
Locus tag: b2199
Name: ccmC
Funciton: heme exporter protein C
Locus tag: b2198
Name: ccmD
Funciton: heme exporter protein D (cytochrome C-type biogenesis protein)
Locus tag: b2197
Name: ccmE
Funciton: cytochrome C-type biogenesis protein
Locus tag: b2196
Name: ccmF
Funciton: heme lyase, CcmF subunit
Locus tag: b2195
Name: ccmG
Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis
Locus tag: b2194
Name: ccmH
Funciton: cytochrome C biogenesis protein
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH -221 5.7 CGCTATATAAATATATTTATAACC b2208
Salmonella typhimurium LT2
Position: -225
Score: 6.26451
Sequence: CGTTATATAAATATCTATATAACT
Locus tag: STM2261
Name: napF
Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
Locus tag: STM2260
Name: napD
Funciton: NapD family protein
Locus tag: STM2259
Name: napA
Funciton: nitrate reductase, periplasmic, large subunit
Locus tag: STM2258
Name: napG
Funciton: quinol dehydrogenase periplasmic component
Locus tag: STM2257
Name: napH
Funciton: quinol dehydrogenase membrane component
Locus tag: STM2256
Name: napB
Funciton: cytochrome c-type protein
Locus tag: STM2255
Name: napC
Funciton: nitrate reductase, cytochrome c-type, periplasmic
Locus tag: STM2254
Name: ccmA
Funciton: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
Locus tag: STM2253
Name: ccmB
Funciton: heme exporter protein B (cytochrome C-type biogenesis protein)
Locus tag: STM2252
Name: ccmC
Funciton: heme exporter protein C
Locus tag: STM2251
Name: ccmD
Funciton: heme exporter protein D (cytochrome C-type biogenesis protein)
Locus tag: STM2250
Name: ccmE
Funciton: cytochrome C-type biogenesis protein
Locus tag: STM2249
Name: ccmF
Funciton: heme lyase, CcmF subunit
Locus tag: STM2248
Name: ccmG
Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis
Locus tag: STM2247
Name: ccmH
Funciton: cytochrome C biogenesis protein
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH -225 6.3 CGTTATATAAATATCTATATAACT STM2261