Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yjfF gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -130
Score: 3.74183
Sequence: AGTTGTGATTAACCTTTTATTT
Locus tag: CKO_03603
Name: ytfQ
Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
Locus tag: CKO_03602
Name: ytfR
Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
Locus tag: CKO_03601
Name: ytfT
Funciton: Putative sugar ABC transport system, permease protein YtfT
Locus tag: CKO_03600
Name: yjfF
Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF -130 3.7 AGTTGTGATTAACCTTTTATTT CKO_03603
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -68
Score: 3.71929
Sequence: TATTGTTAGCCTACTTACCATA
Locus tag: ECA4236
Name: ytfQ
Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
Locus tag: ECA4235
Name: ytfR
Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
Locus tag: ECA4234
Name: ytfT
Funciton: Putative sugar ABC transport system, permease protein YtfT
Locus tag: ECA4233
Name: yjfF
Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF -68 3.7 TATTGTTAGCCTACTTACCATA ECA4236
Escherichia coli str. K-12 substr. MG1655
Position: -98
Score: 3.66628
Sequence: AAGTGTGATGTAACGCAATCTG
Locus tag: b4227
Name: ytfQ
Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
Locus tag: b4485
Name: ytfR
Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
Locus tag: b4230
Name: ytfT
Funciton: Putative sugar ABC transport system, permease protein YtfT
Locus tag: b4231
Name: yjfF
Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF -98 3.7 AAGTGTGATGTAACGCAATCTG b4227
Serratia proteamaculans 568
Position: -163
Score: 4.26201
Sequence: TGATGTGATGCCGCTCATTATT
Locus tag: Spro_4768
Name: ytfQ
Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
Locus tag: Spro_4767
Name: ytfR
Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
Locus tag: Spro_4766
Name: ytfT
Funciton: Putative sugar ABC transport system, permease protein YtfT
Locus tag: Spro_4765
Name: yjfF
Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF -163 4.3 TGATGTGATGCCGCTCATTATT Spro_4768
Yersinia pestis KIM
Position: -229
Score: 3.80091
Sequence: TGGTGTGACGCCGCTCATTATT
Locus tag: y0328
Name: ytfQ
Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
Locus tag: y0329
Name: ytfR
Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
Locus tag: y0330
Name: ytfT
Funciton: Putative sugar ABC transport system, permease protein YtfT
Locus tag: y0331
Name: yjfF
Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF -229 3.8 TGGTGTGACGCCGCTCATTATT y0328