Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Spro_3934 gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Serratia proteamaculans 568
Position: -182
Score: 4.7541
Sequence: AAACGTGTTGTCGATCACAAAT
Locus tag: Spro_3933
Name: yiaK
Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130)
Locus tag: Spro_3934
Name: Spro_3934
Funciton: hypothetical protein
Locus tag: Spro_3935
Name: yiaO
Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor
Locus tag: Spro_3936
Name: lyxK
Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-)
Locus tag: Spro_3937
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: Spro_3938
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: Spro_3939
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-Spro_3934-yiaO-lyxK-sgbH-sgbU-sgbE -182 4.8 AAACGTGTTGTCGATCACAAAT Spro_3933
© 2009-2020 RegPrecise