Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ybhF gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -124
Score: 4.45604
Sequence: TTTTGTGACATACCGCATAAAT
Locus tag: CKO_02331
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: CKO_02332
Name: ybhG
Funciton: hypothetical protein
Locus tag: CKO_02333
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: CKO_02334
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: CKO_02335
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -124 4.5 TTTTGTGACATACCGCATAAAT CKO_02331
Enterobacter sp. 638
Position: -126
Score: 4.38474
Sequence: TTTTGTGACACGGCGCATAAAA
Locus tag: Ent638_1287
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: Ent638_1286
Name: ybhG
Funciton: hypothetical protein
Locus tag: Ent638_1285
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: Ent638_1284
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: Ent638_1283
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -126 4.4 TTTTGTGACACGGCGCATAAAA Ent638_1287
Escherichia coli str. K-12 substr. MG1655
Position: -123
Score: 4.52519
Sequence: TTTTGTGACGCAGCGCATAAAT
Locus tag: b0796
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: b0795
Name: ybhG
Funciton: hypothetical protein
Locus tag: b0794
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: b0793
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: b0792
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -123 4.5 TTTTGTGACGCAGCGCATAAAT b0796
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -224
Score: 3.58566
Sequence: AAATGAAACGGTATTCAAAAAA
Position: -118
Score: 4.67089
Sequence: AATTGTTAAGCCCATCACAAAT
Locus tag: KPN_00825
Name: KPN_00825
Funciton: putative bacterial regulatory protein, LysR
Locus tag: KPN_00824
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: KPN_00823
Name: ybhG
Funciton: hypothetical protein
Locus tag: KPN_00822
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: KPN_00821
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: KPN_00820
Name: ybhR
Funciton: ABC-2 type transporter
KPN_00825-ybiH-ybhG-ybhF-ybhS-ybhR -224 3.6 AAATGAAACGGTATTCAAAAAA KPN_00825
-118 4.7 AATTGTTAAGCCCATCACAAAT
Proteus mirabilis HI4320
Position: -160
Score: 3.62258
Sequence: AATTTTTAAATAAATCATGTTT
Locus tag: PMI0619
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: PMI0618
Name: ybhG
Funciton: hypothetical protein
Locus tag: PMI0617
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: PMI0616
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: PMI0615
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -160 3.6 AATTTTTAAATAAATCATGTTT PMI0619
Salmonella typhimurium LT2
Position: -124
Score: 4.74352
Sequence: TTTTGTGATGCGGCGCATAAAT
Locus tag: STM0819
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: STM0818
Name: ybhG
Funciton: hypothetical protein
Locus tag: STM0817
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: STM0816
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: STM0815
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -124 4.7 TTTTGTGATGCGGCGCATAAAT STM0819
Serratia proteamaculans 568
Position: -146
Score: 4.57998
Sequence: TTAAGTGACGCAGAGCACAATA
Locus tag: Spro_1330
Name: ybiH
Funciton: putative transcriptional regulator
Locus tag: Spro_1329
Name: ybhG
Funciton: hypothetical protein
Locus tag: Spro_1328
Name: ybhF
Funciton: ABC transporter-related protein
Locus tag: Spro_1327
Name: ybhS
Funciton: ABC-2 type transporter
Locus tag: Spro_1326
Name: ybhR
Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR -146 4.6 TTAAGTGACGCAGAGCACAATA Spro_1330