Orthologous regulated operons containing nanE gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -116 Score: 4.16467 Sequence: TTTAGTGAAGTAGATCGCACTC Locus tag: CKO_04629 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: CKO_04628 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: CKO_04626 Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) Locus tag: CKO_04625 Name: yhcI Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: CKO_04624 Name: yhcH Funciton: Putative sugar isomerase involved in processing of exogenous sialic acid
nanA-nanT-nanE-yhcI-yhcH	-116	4.2	TTTAGTGAAGTAGATCGCACTC	CKO_04629
Escherichia coli str. K-12 substr. MG1655
Position: -115 Score: 4.61567 Sequence: TTTAGTGAAGCAGATCGCATTA Locus tag: b3225 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: b3224 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: b3223 Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) Locus tag: b3222 Name: yhcI Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: b3221 Name: yhcH Funciton: Putative sugar isomerase involved in processing of exogenous sialic acid
nanA-nanT-nanE-yhcI-yhcH	-115	4.6	TTTAGTGAAGCAGATCGCATTA	b3225
Salmonella typhimurium LT2
Position: -113 Score: 4.41812 Sequence: TTTAGTGAAGCAGATCGCACTA Locus tag: STM3339 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: STM3338 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: STM3337 Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) Locus tag: STM3336 Name: yhcI Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: STM3335 Name: yhcH Funciton: Putative sugar isomerase involved in processing of exogenous sialic acid
nanA-nanT-nanE-yhcI-yhcH	-113	4.4	TTTAGTGAAGCAGATCGCACTA	STM3339