Orthologous regulated operons containing lsrC gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -183 Score: 4.30528 Sequence: ATCTGTGATGGCAACCACAGTT Locus tag: b1513 Name: lsrA Funciton: ABC transporter related Locus tag: b1514 Name: lsrC Funciton: putative ABC transport system permease protein Locus tag: b1515 Name: lsrD Funciton: putative ABC transport system permease protein Locus tag: b1516 Name: lsrB Funciton: putative ABC superfamily (peri_perm), sugar transport protein Locus tag: b1517 Name: lsrF Funciton: hypothetical protein Locus tag: b1518 Name: lsrG Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG	-183	4.3	ATCTGTGATGGCAACCACAGTT	b1513
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -162 Score: 3.76441 Sequence: AAGTGTGAGCCGACTGGCAAAA Locus tag: KPN_03507 Name: lsrA Funciton: ABC transporter related Locus tag: KPN_03506 Name: lsrC Funciton: putative ABC transport system permease protein Locus tag: KPN_03505 Name: lsrD Funciton: putative ABC transport system permease protein Locus tag: KPN_03504 Name: lsrB Funciton: putative ABC superfamily (peri_perm), sugar transport protein Locus tag: KPN_03503 Name: lsrF Funciton: hypothetical protein Locus tag: KPN_03502 Name: lsrG Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG	-162	3.8	AAGTGTGAGCCGACTGGCAAAA	KPN_03507
Salmonella typhimurium LT2
Position: -185 Score: 3.99528 Sequence: AACCGTGATTAACGCCACAAAA Position: -116 Score: 3.83065 Sequence: AAACGTGATCTGGATGAGAGTT Locus tag: STM4074 Name: lsrA Funciton: ABC transporter related Locus tag: STM4075 Name: lsrC Funciton: putative ABC transport system permease protein Locus tag: STM4076 Name: lsrD Funciton: putative ABC transport system permease protein Locus tag: STM4077 Name: lsrB Funciton: putative ABC superfamily (peri_perm), sugar transport protein Locus tag: STM4078 Name: lsrF Funciton: hypothetical protein Locus tag: STM4079.S Name: lsrG Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG	-185	4	AACCGTGATTAACGCCACAAAA	STM4074
	-116	3.8	AAACGTGATCTGGATGAGAGTT