Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hemY gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -220
Score: 4.20432
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: CKO_00147
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: CKO_00146
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: CKO_00145
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: CKO_00144
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -220 4.2 AAACGTGATCAATTTAACACCT CKO_00147
Edwardsiella tarda EIB202
Position: -205
Score: 4.20432
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: ETAE_0118
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: ETAE_0117
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: ETAE_0116
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: ETAE_0115
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -205 4.2 AAACGTGATCAATTTAACACCT ETAE_0118
Enterobacter sp. 638
Position: -211
Score: 4.158
Sequence: AAACGTGATCAATCTAACACCT
Locus tag: Ent638_3987
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: Ent638_3988
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: Ent638_3989
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: Ent638_3990
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -211 4.2 AAACGTGATCAATCTAACACCT Ent638_3987
Escherichia coli str. K-12 substr. MG1655
Position: -236
Score: 4.20432
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: b3805
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: b3804
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: b3803
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: b3802
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -236 4.2 AAACGTGATCAATTTAACACCT b3805
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -232
Score: 4.20432
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: KPN_04304
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: KPN_04303
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: KPN_04302
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: KPN_04301
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -232 4.2 AAACGTGATCAATTTAACACCT KPN_04304
Salmonella typhimurium LT2
Position: -219
Score: 4.20432
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: STM3938
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: STM3937
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: STM3936
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: STM3935
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -219 4.2 AAACGTGATCAATTTAACACCT STM3938
Serratia proteamaculans 568
Position: -223
Score: 4.158
Sequence: AAACGTGATCAATCTAACACCT
Locus tag: Spro_0178
Name: hemC
Funciton: porphobilinogen deaminase
Locus tag: Spro_0177
Name: hemD
Funciton: uroporphyrinogen-III synthase
Locus tag: Spro_0176
Name: hemX
Funciton: uroporphyrinogen III methylase
Locus tag: Spro_0175
Name: hemY
Funciton: HemY protein
hemC-hemD-hemX-hemY -223 4.2 AAACGTGATCAATCTAACACCT Spro_0178