Orthologous regulated operons containing ebgR gene
Regulog: | EbgR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galactosides utilization |
Effector: | Beta-galactosides |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -201
Score: 5.73975 Sequence: TAAAATTTTACTAAACTATAG
Locus tag: b3075
Name: ebgR Funciton: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
||||
ebgR | -201 | 5.7 | TAAAATTTTACTAAACTATAG | b3075 |
Serratia proteamaculans 568 | ||||
Position: -223
Score: 5.85515 Sequence: AAAATATTTAGTAAAAAATAC
Locus tag: Spro_1972
Name: ebgR Funciton: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
||||
ebgR | -223 | 5.9 | AAAATATTTAGTAAAAAATAC | Spro_1972 |