Orthologous regulated operons containing ribA2 gene
| Regulog: | RutR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cupriavidus taiwanensis | ||||
|
Position: -43
Score: 7.13329 Sequence: ACCTGACCGATTGGTCAGGA
Locus tag: RALTA_B1434
Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
Locus tag: RALTA_B1433
Name: PF07958 Funciton: Conserved hypothetical protein
Locus tag: RALTA_B1432
Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Locus tag: RALTA_B1431
Name: rutR Funciton: Transcriptional regulator, TetR family
Locus tag: RALTA_B1430
Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1) |
||||
| ribA2-PF07958-upp-rutR-codA | -43 | 7.1 | ACCTGACCGATTGGTCAGGA | RALTA_B1434 |
| Ralstonia eutropha H16 | ||||
|
Position: -43
Score: 7.31907 Sequence: ACCTGACCATTTGGTCAGGA
Locus tag: H16_B1597
Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
Locus tag: H16_B1596
Name: PF07958 Funciton: Conserved hypothetical protein
Locus tag: H16_B1595
Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Locus tag: H16_B1594
Name: rutR Funciton: Transcriptional regulator, TetR family
Locus tag: H16_B1593
Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1) |
||||
| ribA2-PF07958-upp-rutR-codA | -43 | 7.3 | ACCTGACCATTTGGTCAGGA | H16_B1597 |
| Ralstonia eutropha JMP134 | ||||
|
Position: -45
Score: 7.13329 Sequence: ACTTGACCATTTGGTCAGGA
Locus tag: Reut_B3985
Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
Locus tag: Reut_B3986
Name: PF07958 Funciton: Conserved hypothetical protein
Locus tag: Reut_B3987
Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Locus tag: Reut_B3988
Name: rutR Funciton: Transcriptional regulator, TetR family
Locus tag: Reut_B3989
Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor
Locus tag: Reut_B3990
Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: Reut_B3991
Name: ppuC Funciton: Predicted ABC transporter, permease protein
Locus tag: Reut_B3992
Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor
Locus tag: Reut_B3993
Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1) |
||||
| ribA2-PF07958-upp-rutR-ppuB-ppuA-ppuC-ppuD-codA | -45 | 7.1 | ACTTGACCATTTGGTCAGGA | Reut_B3985 |
| Ralstonia metallidurans CH34 | ||||
|
Position: -45
Score: 6.94751 Sequence: ACCTGACCAACTGGTCAGGT
Locus tag: Rmet_4572
Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
Locus tag: Rmet_4571
Name: PF07958 Funciton: Conserved hypothetical protein
Locus tag: Rmet_4570
Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Locus tag: Rmet_4569
Name: rutR Funciton: Transcriptional regulator, TetR family
Locus tag: Rmet_4568
Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1) |
||||
| ribA2-PF07958-upp-rutR-codA | -45 | 6.9 | ACCTGACCAACTGGTCAGGT | Rmet_4572 |