Orthologous regulated operons containing ribA2 gene

Properties
Regulog:	RutR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor (activator)
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/beta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -43 Score: 7.13329 Sequence: ACCTGACCGATTGGTCAGGA Locus tag: RALTA_B1434 Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog Locus tag: RALTA_B1433 Name: PF07958 Funciton: Conserved hypothetical protein Locus tag: RALTA_B1432 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: RALTA_B1431 Name: rutR Funciton: Transcriptional regulator, TetR family Locus tag: RALTA_B1430 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
ribA2-PF07958-upp-rutR-codA	-43	7.1	ACCTGACCGATTGGTCAGGA	RALTA_B1434
Ralstonia eutropha H16
Position: -43 Score: 7.31907 Sequence: ACCTGACCATTTGGTCAGGA Locus tag: H16_B1597 Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog Locus tag: H16_B1596 Name: PF07958 Funciton: Conserved hypothetical protein Locus tag: H16_B1595 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: H16_B1594 Name: rutR Funciton: Transcriptional regulator, TetR family Locus tag: H16_B1593 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
ribA2-PF07958-upp-rutR-codA	-43	7.3	ACCTGACCATTTGGTCAGGA	H16_B1597
Ralstonia eutropha JMP134
Position: -45 Score: 7.13329 Sequence: ACTTGACCATTTGGTCAGGA Locus tag: Reut_B3985 Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog Locus tag: Reut_B3986 Name: PF07958 Funciton: Conserved hypothetical protein Locus tag: Reut_B3987 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: Reut_B3988 Name: rutR Funciton: Transcriptional regulator, TetR family Locus tag: Reut_B3989 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: Reut_B3990 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: Reut_B3991 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: Reut_B3992 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: Reut_B3993 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
ribA2-PF07958-upp-rutR-ppuB-ppuA-ppuC-ppuD-codA	-45	7.1	ACTTGACCATTTGGTCAGGA	Reut_B3985
Ralstonia metallidurans CH34
Position: -45 Score: 6.94751 Sequence: ACCTGACCAACTGGTCAGGT Locus tag: Rmet_4572 Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog Locus tag: Rmet_4571 Name: PF07958 Funciton: Conserved hypothetical protein Locus tag: Rmet_4570 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: Rmet_4569 Name: rutR Funciton: Transcriptional regulator, TetR family Locus tag: Rmet_4568 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
ribA2-PF07958-upp-rutR-codA	-45	6.9	ACCTGACCAACTGGTCAGGT	Rmet_4572