Orthologous regulated operons containing napF gene

Properties
Regulog:	ModE - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma

Built upon 55 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Edwardsiella tarda EIB202
Position: -246 Score: 5.95823 Sequence: CGCTGTATATTTAAGTAAATAGCG Locus tag: ETAE_1114 Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA) Locus tag: ETAE_1115 Name: napD Funciton: NapD family protein Locus tag: ETAE_1116 Name: napA Funciton: nitrate reductase, periplasmic, large subunit Locus tag: ETAE_1117 Name: napG Funciton: quinol dehydrogenase periplasmic component Locus tag: ETAE_1118 Name: napH Funciton: quinol dehydrogenase membrane component Locus tag: ETAE_1119 Name: napB Funciton: cytochrome c-type protein Locus tag: ETAE_1120 Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic
napF-napD-napA-napG-napH-napB-napC	-246	6	CGCTGTATATTTAAGTAAATAGCG	ETAE_1114
Escherichia coli str. K-12 substr. MG1655
Position: -221 Score: 5.74115 Sequence: CGCTATATAAATATATTTATAACC Locus tag: b2208 Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA) Locus tag: b2207 Name: napD Funciton: NapD family protein Locus tag: b2206 Name: napA Funciton: nitrate reductase, periplasmic, large subunit Locus tag: b2205 Name: napG Funciton: quinol dehydrogenase periplasmic component Locus tag: b2204 Name: napH Funciton: quinol dehydrogenase membrane component Locus tag: b2203 Name: napB Funciton: cytochrome c-type protein Locus tag: b2202 Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic Locus tag: b2201 Name: ccmA Funciton: ATP binding protein of heme exporter A Locus tag: b2200 Name: ccmB Funciton: heme exporter protein B (cytochrome C-type biogenesis protein) Locus tag: b2199 Name: ccmC Funciton: heme exporter protein C Locus tag: b2198 Name: ccmD Funciton: heme exporter protein D (cytochrome C-type biogenesis protein) Locus tag: b2197 Name: ccmE Funciton: cytochrome C-type biogenesis protein Locus tag: b2196 Name: ccmF Funciton: heme lyase, CcmF subunit Locus tag: b2195 Name: ccmG Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis Locus tag: b2194 Name: ccmH Funciton: cytochrome C biogenesis protein
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH	-221	5.7	CGCTATATAAATATATTTATAACC	b2208
Salmonella typhimurium LT2
Position: -225 Score: 6.26451 Sequence: CGTTATATAAATATCTATATAACT Locus tag: STM2261 Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA) Locus tag: STM2260 Name: napD Funciton: NapD family protein Locus tag: STM2259 Name: napA Funciton: nitrate reductase, periplasmic, large subunit Locus tag: STM2258 Name: napG Funciton: quinol dehydrogenase periplasmic component Locus tag: STM2257 Name: napH Funciton: quinol dehydrogenase membrane component Locus tag: STM2256 Name: napB Funciton: cytochrome c-type protein Locus tag: STM2255 Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic Locus tag: STM2254 Name: ccmA Funciton: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein Locus tag: STM2253 Name: ccmB Funciton: heme exporter protein B (cytochrome C-type biogenesis protein) Locus tag: STM2252 Name: ccmC Funciton: heme exporter protein C Locus tag: STM2251 Name: ccmD Funciton: heme exporter protein D (cytochrome C-type biogenesis protein) Locus tag: STM2250 Name: ccmE Funciton: cytochrome C-type biogenesis protein Locus tag: STM2249 Name: ccmF Funciton: heme lyase, CcmF subunit Locus tag: STM2248 Name: ccmG Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis Locus tag: STM2247 Name: ccmH Funciton: cytochrome C biogenesis protein
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH	-225	6.3	CGTTATATAAATATCTATATAACT	STM2261
Serratia proteamaculans 568
Position: -422 Score: 6.05929 Sequence: CGCTGTATAATCAACTAGATAGCG Locus tag: Spro_3488 Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA) Locus tag: Spro_3487 Name: napD Funciton: NapD family protein Locus tag: Spro_3486 Name: napA Funciton: nitrate reductase, periplasmic, large subunit Locus tag: Spro_3485 Name: napB Funciton: cytochrome c-type protein Locus tag: Spro_3484 Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic
napF-napD-napA-napB-napC	-422	6.1	CGCTGTATAATCAACTAGATAGCG	Spro_3488
Yersinia pestis KIM
Position: -282 Score: 5.13042 Sequence: CGTTATATATATTAAGTGATAACG Locus tag: y1442 Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA) Locus tag: y1443 Name: napD Funciton: NapD family protein
napF-napD	-282	5.1	CGTTATATATATTAAGTGATAACG	y1442