Orthologous regulated operons containing ccmD gene
Regulog: | ModE - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdopterin biosynthesis; Molybdenum homeostasis |
Effector: | Molybdate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -221
Score: 5.74115 Sequence: CGCTATATAAATATATTTATAACC
Locus tag: b2208
Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
Locus tag: b2207
Name: napD Funciton: NapD family protein
Locus tag: b2206
Name: napA Funciton: nitrate reductase, periplasmic, large subunit
Locus tag: b2205
Name: napG Funciton: quinol dehydrogenase periplasmic component
Locus tag: b2204
Name: napH Funciton: quinol dehydrogenase membrane component
Locus tag: b2203
Name: napB Funciton: cytochrome c-type protein
Locus tag: b2202
Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic
Locus tag: b2201
Name: ccmA Funciton: ATP binding protein of heme exporter A
Locus tag: b2200
Name: ccmB Funciton: heme exporter protein B (cytochrome C-type biogenesis protein)
Locus tag: b2199
Name: ccmC Funciton: heme exporter protein C
Locus tag: b2198
Name: ccmD Funciton: heme exporter protein D (cytochrome C-type biogenesis protein)
Locus tag: b2197
Name: ccmE Funciton: cytochrome C-type biogenesis protein
Locus tag: b2196
Name: ccmF Funciton: heme lyase, CcmF subunit
Locus tag: b2195
Name: ccmG Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis
Locus tag: b2194
Name: ccmH Funciton: cytochrome C biogenesis protein |
||||
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH | -221 | 5.7 | CGCTATATAAATATATTTATAACC | b2208 |
Salmonella typhimurium LT2 | ||||
Position: -225
Score: 6.26451 Sequence: CGTTATATAAATATCTATATAACT
Locus tag: STM2261
Name: napF Funciton: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
Locus tag: STM2260
Name: napD Funciton: NapD family protein
Locus tag: STM2259
Name: napA Funciton: nitrate reductase, periplasmic, large subunit
Locus tag: STM2258
Name: napG Funciton: quinol dehydrogenase periplasmic component
Locus tag: STM2257
Name: napH Funciton: quinol dehydrogenase membrane component
Locus tag: STM2256
Name: napB Funciton: cytochrome c-type protein
Locus tag: STM2255
Name: napC Funciton: nitrate reductase, cytochrome c-type, periplasmic
Locus tag: STM2254
Name: ccmA Funciton: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
Locus tag: STM2253
Name: ccmB Funciton: heme exporter protein B (cytochrome C-type biogenesis protein)
Locus tag: STM2252
Name: ccmC Funciton: heme exporter protein C
Locus tag: STM2251
Name: ccmD Funciton: heme exporter protein D (cytochrome C-type biogenesis protein)
Locus tag: STM2250
Name: ccmE Funciton: cytochrome C-type biogenesis protein
Locus tag: STM2249
Name: ccmF Funciton: heme lyase, CcmF subunit
Locus tag: STM2248
Name: ccmG Funciton: periplasmic thioredoxin of cytochrome c-type biogenesis
Locus tag: STM2247
Name: ccmH Funciton: cytochrome C biogenesis protein |
||||
napF-napD-napA-napG-napH-napB-napC-ccmA-ccmB-ccmC-ccmD-ccmE-ccmF-ccmG-ccmH | -225 | 6.3 | CGTTATATAAATATCTATATAACT | STM2261 |