Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing metK gene

Properties
Regulog: SahR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicaulis alexandrii HTCC2633
Position: -18
Score: 6.10685
Sequence: ATATAAAGATCGCTTTATAT
Locus tag: OA2633_10239
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
metK -18 6.1 ATATAAAGATCGCTTTATAT OA2633_10239
© 2009-2020 RegPrecise