Orthologous regulated operons containing hom gene
| Regulog: | SahR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Oceanicaulis alexandrii HTCC2633 | ||||
|
Position: -202
Score: 6.64271 Sequence: ATATAAAGATATCCTTATAT
Locus tag: OA2633_08279
Name: hom Funciton: Homoserine dehydrogenase (EC 1.1.1.3)
Locus tag: OA2633_08274
Name: metX2 Funciton: Homoserine O-acetyltransferase (EC 2.3.1.31)
Locus tag: OA2633_08269
Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) |
||||
| hom-metX2-metB | -202 | 6.6 | ATATAAAGATATCCTTATAT | OA2633_08279 |