Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmuP gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -87
Score: 3.80484
Sequence: CGTTTATAGTAATTATAAGAC
Locus tag: RPA2121
Name: hmuP
Funciton: HmuP hemin uptake protein
Locus tag: RPA2120
Name: hmuT
Funciton: Hemin ABC transporter, hemin-binding protein
Locus tag: RPA2119
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: RPA2118
Name: hmuV
Funciton: Hemin ABC transporter, ATPase component
hmuP-hmuT-hmuU-hmuV -87 3.8 CGTTTATAGTAATTATAAGAC RPA2121
© 2009-2020 RegPrecise