Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Atu2462 gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -162
Score: 3.91903
Sequence: AAGTTATAATTGCTTTAATCA
Locus tag: RPA2124
Name: hmuR
Funciton: TonB-dependent haem/haemoglobin receptor
Locus tag: RPA2125
Name: null
Funciton: Hypothetical, distant similarity with heme-degrading oxygenase IsdG
Locus tag: RPA2126
Name: null
Funciton: Putative heme iron utilization protein
Locus tag: RPA2127
Name: exbB1
Funciton: putative exbB, uptake of enterochelin; tonB-dependent uptake of B colicins
Locus tag: RPA2128
Name: exbD1
Funciton: biopolymer transport protein ExbD/TolR
Locus tag: RPA2129
Name: tonB
Funciton: possible energy transducer TonB, C-terminal region
hmuR-RPA2125-RPA2126-exbB1-exbD1-tonB -162 3.9 AAGTTATAATTGCTTTAATCA RPA2124
© 2009-2020 RegPrecise