Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fhuA1 gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -169
Score: 4.7786
Sequence: CGTCTAGAAGGATTCCAAATC
Locus tag: blr4504
Name: fhuA1
Funciton: Outer membrane receptor for ferrienterochelin and colicins
fhuA1 -169 4.8 CGTCTAGAAGGATTCCAAATC blr4504
© 2009-2020 RegPrecise