Orthologous regulated operons containing dsrO gene
Regulog: | Rex - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | Rex |
Regulation mode: | repressor |
Biological process: | Energy metabolism |
Effector: | NADH |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfohalobium retbaense DSM 5692 | ||||
Position: -70
Score: 3.84183 Sequence: AATGTGAAATTCGGCACACA
Locus tag: Dret_0234
Name: null Funciton: hypothetical protein
Locus tag: Dret_0235
Name: dsrM Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Dret_0236
Name: dsrK Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Dret_0237
Name: dsrJ Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Dret_0238
Name: dsrO Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Dret_0239
Name: dsrP Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) |
||||
Dret_0234-dsrM-dsrK-dsrJ-dsrO-dsrP | -70 | 3.8 | AATGTGAAATTCGGCACACA | Dret_0234 |
Desulfomicrobium baculatum DSM 4028 | ||||
Position: -134
Score: 4.9385 Sequence: CTTGTTTCATTTTTCACAAA
Locus tag: Dbac_0269
Name: null Funciton: hypothetical protein
Locus tag: Dbac_0270
Name: dsrM Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Dbac_0271
Name: dsrK Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Dbac_0272
Name: dsrJ Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Dbac_0273
Name: dsrO Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Dbac_0274
Name: dsrP Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) |
||||
Dbac_0269-dsrM-dsrK-dsrJ-dsrO-dsrP | -134 | 4.9 | CTTGTTTCATTTTTCACAAA | Dbac_0269 |
Desulfovibrio desulfuricans G20 | ||||
Position: -167
Score: 3.97665 Sequence: TATGTGAAAAAAATAATTAT
Locus tag: Dde_2270
Name: null Funciton: hypothetical protein
Locus tag: Dde_2271
Name: dsrM Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Dde_2272
Name: dsrK Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Dde_2273
Name: dsrJ Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Dde_2274
Name: dsrO Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Dde_2275
Name: dsrP Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) |
||||
Dde_2270-dsrM-dsrK-dsrJ-dsrO-dsrP | -167 | 4 | TATGTGAAAAAAATAATTAT | Dde_2270 |
Desulfovibrio salexigens DSM 2638 | ||||
Position: -118
Score: 3.8697 Sequence: AGTGTGACAGAATTCACATT
Locus tag: Desal_0187
Name: null Funciton: hypothetical protein
Locus tag: Desal_0186
Name: dsrM Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Desal_0185
Name: dsrK Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Desal_0184
Name: dsrJ Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Desal_0183
Name: dsrO Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Desal_0182
Name: dsrP Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) |
||||
Desal_0187-dsrM-dsrK-dsrJ-dsrO-dsrP | -118 | 3.9 | AGTGTGACAGAATTCACATT | Desal_0187 |
Desulfovibrio vulgaris Hildenborough | ||||
Position: -40
Score: 4.05254 Sequence: TATGTGAAAAAAATCATTTT
Locus tag: DVU1292
Name: null Funciton: hypothetical protein
Locus tag: DVU1291
Name: null Funciton: hypothetical protein
Locus tag: DVU1290
Name: dsrM Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: DVU1289
Name: dsrK Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: DVU1288
Name: dsrJ Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: DVU1287
Name: dsrO Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: DVU1286
Name: dsrP Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB) |
||||
DVU1292-DVU1291-dsrM-dsrK-dsrJ-dsrO-dsrP | -40 | 4.1 | TATGTGAAAAAAATCATTTT | DVU1292 |