Orthologous regulated operons containing bglB gene

Properties
Regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 28 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Enterobacter sp. 638
Position: -72 Score: 4.73279 Sequence: AATGGAAACCGGTTTCCATA Locus tag: Ent638_0038 Name: celA Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: Ent638_0037 Name: celB Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: Ent638_0036 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Ent638_0035 Name: celC Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: Ent638_0034 Name: bglP Funciton: putative outer membrane porin for beta-glucoside utilization
celA-celB-bglB-celC-bglP	-72	4.7	AATGGAAACCGGTTTCCATA	Ent638_0038

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --