Orthologous regulated operons containing celA gene
| Regulog: | AscG - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization; Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate; Beta-glucoside-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -72
Score: 4.73279 Sequence: AATGGAAACCGGTTTCCATA
Locus tag: Ent638_0038
Name: celA Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: Ent638_0037
Name: celB Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: Ent638_0036
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Ent638_0035
Name: celC Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: Ent638_0034
Name: bglP Funciton: putative outer membrane porin for beta-glucoside utilization |
||||
| celA-celB-bglB-celC-bglP | -72 | 4.7 | AATGGAAACCGGTTTCCATA | Ent638_0038 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -198
Score: 4.34116 Sequence: TTTGGAAACCGATTTTCCAT
Position: -72
Score: 4.61925 Sequence: AATGGAAACCGGTTTCCGTC
Locus tag: KPN_04054
Name: celA Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: KPN_04055
Name: celB Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: KPN_04056
Name: celC Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: KPN_04057
Name: bglP Funciton: putative outer membrane porin for beta-glucoside utilization |
||||
| celA-celB-celC-bglP | -198 | 4.3 | TTTGGAAACCGATTTTCCAT | KPN_04054 |
| -72 | 4.6 | AATGGAAACCGGTTTCCGTC | ||