Orthologous regulated operons containing celA2 gene
| Regulog: | AscG - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization; Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate; Beta-glucoside-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -117
Score: 5.61192 Sequence: TACTGCAACCGGTTTCAGTT
Locus tag: CKO_02999
Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: CKO_03000
Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
||||
| celA2-celC2 | -117 | 5.6 | TACTGCAACCGGTTTCAGTT | CKO_02999 |
| Enterobacter sp. 638 | ||||
|
Position: -126
Score: 5.42311 Sequence: AATTGAAACCGGTTTCATAG
Locus tag: Ent638_0200
Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: Ent638_0199
Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
||||
| celA2-celC2 | -126 | 5.4 | AATTGAAACCGGTTTCATAG | Ent638_0200 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -151
Score: 5.75845 Sequence: AAATGAAACCGGTTTCAATT
Locus tag: KPN_04369
Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: KPN_04368
Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
||||
| celA2-celC2 | -151 | 5.8 | AAATGAAACCGGTTTCAATT | KPN_04369 |