Orthologous regulated operons containing celC2 gene

Properties
Regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 28 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -117 Score: 5.61192 Sequence: TACTGCAACCGGTTTCAGTT Locus tag: CKO_02999 Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: CKO_03000 Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2	-117	5.6	TACTGCAACCGGTTTCAGTT	CKO_02999
Enterobacter sp. 638
Position: -126 Score: 5.42311 Sequence: AATTGAAACCGGTTTCATAG Locus tag: Ent638_0200 Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: Ent638_0199 Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2	-126	5.4	AATTGAAACCGGTTTCATAG	Ent638_0200
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -151 Score: 5.75845 Sequence: AAATGAAACCGGTTTCAATT Locus tag: KPN_04369 Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: KPN_04368 Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2-celC2	-151	5.8	AAATGAAACCGGTTTCAATT	KPN_04369

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --