Orthologous regulated operons containing BH0913 gene
| Regulog: | GamR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucosamine utilization |
| Effector: | Glucosamine-6-phosphate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus clausii KSM-K16 | ||||
|
Position: -124
Score: 5.6533 Sequence: ATATTTGTAATTACTAATCA
Position: -100
Score: 5.24467 Sequence: AAATTTGTAACTACCTATTT
Locus tag: ABC0644
Name: null Funciton: Predicted chitooligosaccharide deacetylase |
||||
| ABC0644 | -124 | 5.7 | ATATTTGTAATTACTAATCA | ABC0644 |
| -100 | 5.2 | AAATTTGTAACTACCTATTT | ||
| Bacillus halodurans C-125 | ||||
|
Position: -116
Score: 5.55165 Sequence: ATATTTGTTACTACTAATCA
Position: -92
Score: 4.79076 Sequence: TTAATTGTAGTTACTTATTT
Position: -60
Score: 4.55935 Sequence: TTATACGTAATGACAATTTT
Locus tag: BH0913
Name: BH0913 Funciton: Predicted chitooligosaccharide deacetylase |
||||
| BH0913 | -116 | 5.6 | ATATTTGTTACTACTAATCA | BH0913 |
| -92 | 4.8 | TTAATTGTAGTTACTTATTT | ||
| -60 | 4.6 | TTATACGTAATGACAATTTT | ||
| Bacillus licheniformis DSM 13 | ||||
|
Position: -110
Score: 5.19774 Sequence: TAACATGTTATAACAAATTT
Position: -96
Score: 4.5882 Sequence: AAATTTGTCCATACATATTT
Position: -82
Score: 6.23247 Sequence: ATATTTGTTATAACAAATTG
Locus tag: BLi00336
Name: gamR Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: BLi00337
Name: null Funciton: Predicted chitooligosaccharide deacetylase |
||||
| gamR-BLi00337 | -110 | 5.2 | TAACATGTTATAACAAATTT | BLi00336 |
| -96 | 4.6 | AAATTTGTCCATACATATTT | ||
| -82 | 6.2 | ATATTTGTTATAACAAATTG | ||
| Oceanobacillus iheyensis HTE831 | ||||
|
Position: -81
Score: 5.75644 Sequence: AAATTTGTTATAACACAATT
Locus tag: OB2272
Name: gamR Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: OB2271
Name: null Funciton: Predicted chitooligosaccharide deacetylase |
||||
| gamR-OB2271 | -81 | 5.8 | AAATTTGTTATAACACAATT | OB2272 |