Orthologous regulated operons containing phnF gene
Regulog: | PhnF - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Phosphonate utilization |
Effector: | |
Phylum: | Proteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -85
Score: 5.27054 Sequence: TTGTCCATTTAATTATACAA
Locus tag: Jann_2856
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -85 | 5.3 | TTGTCCATTTAATTATACAA | Jann_2856 |
Loktanella vestfoldensis SKA53 | ||||
Position: -71
Score: 4.84395 Sequence: TTTACTATACAACTAGACAA
Locus tag: SKA53_06742
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -71 | 4.8 | TTTACTATACAACTAGACAA | SKA53_06742 |
Oceanicola batsensis HTCC2597 | ||||
Position: -79
Score: 5.95419 Sequence: TTGTCTATTTACCTATACAA
Locus tag: OB2597_05580
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -79 | 6 | TTGTCTATTTACCTATACAA | OB2597_05580 |
Paracoccus denitrificans PD1222 | ||||
Position: -93
Score: 5.92641 Sequence: TTGTCTAGTTTTCTATACAA
Position: -85
Score: 5.42379 Sequence: TTTTCTATACAACTAGACAA
Locus tag: Pden_4783
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -93 | 5.9 | TTGTCTAGTTTTCTATACAA | Pden_4783 |
-85 | 5.4 | TTTTCTATACAACTAGACAA | ||
Rhodobacterales bacterium HTCC2654 | ||||
Position: -75
Score: 4.96822 Sequence: TTGTCTACGCTACTATACAA
Locus tag: RB2654_09759
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -75 | 5 | TTGTCTACGCTACTATACAA | RB2654_09759 |
Roseobacter sp. MED193 | ||||
Position: -76
Score: 4.84395 Sequence: TGTTCTATACAACTAGACAA
Locus tag: MED193_17599
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -76 | 4.8 | TGTTCTATACAACTAGACAA | MED193_17599 |
Roseovarius nubinhibens ISM | ||||
Position: -94
Score: 5.50138 Sequence: TTGTCTATGTTATTATACAA
Locus tag: ISM_06265
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -94 | 5.5 | TTGTCTATGTTATTATACAA | ISM_06265 |
Roseovarius sp. 217 | ||||
Position: -85
Score: 5.3902 Sequence: TTGTCGATATCACTATACAA
Locus tag: ROS217_04230
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -85 | 5.4 | TTGTCGATATCACTATACAA | ROS217_04230 |
Silicibacter pomeroyi DSS-3 | ||||
Position: -76
Score: 4.84395 Sequence: TTCACTATACAACTAGACAA
Locus tag: SPO0467
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -76 | 4.8 | TTCACTATACAACTAGACAA | SPO0467 |
Sulfitobacter sp. EE-36 | ||||
Position: -76
Score: 6.00362 Sequence: TTGTCTATACAACTAGACAA
Locus tag: EE36_08868
Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family |
||||
phnF | -76 | 6 | TTGTCTATACAACTAGACAA | EE36_08868 |