Orthologous regulated operons containing ytfR gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -130 Score: 3.74183 Sequence: AGTTGTGATTAACCTTTTATTT Locus tag: CKO_03603 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: CKO_03602 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: CKO_03601 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: CKO_03600 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF	-130	3.7	AGTTGTGATTAACCTTTTATTT	CKO_03603
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -68 Score: 3.71929 Sequence: TATTGTTAGCCTACTTACCATA Locus tag: ECA4236 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: ECA4235 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: ECA4234 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: ECA4233 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF	-68	3.7	TATTGTTAGCCTACTTACCATA	ECA4236
Escherichia coli str. K-12 substr. MG1655
Position: -98 Score: 3.66628 Sequence: AAGTGTGATGTAACGCAATCTG Locus tag: b4227 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: b4485 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: b4230 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: b4231 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF	-98	3.7	AAGTGTGATGTAACGCAATCTG	b4227
Serratia proteamaculans 568
Position: -163 Score: 4.26201 Sequence: TGATGTGATGCCGCTCATTATT Locus tag: Spro_4768 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: Spro_4767 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: Spro_4766 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: Spro_4765 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF	-163	4.3	TGATGTGATGCCGCTCATTATT	Spro_4768
Yersinia pestis KIM
Position: -229 Score: 3.80091 Sequence: TGGTGTGACGCCGCTCATTATT Locus tag: y0328 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: y0329 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: y0330 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: y0331 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
ytfQ-ytfR-ytfT-yjfF	-229	3.8	TGGTGTGACGCCGCTCATTATT	y0328