Orthologous regulated operons containing yiaN gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -175 Score: 4.10756 Sequence: AAGTGTGCCGTAGTTCACGATC Locus tag: b3575 Name: yiaK Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130) Locus tag: b3576 Name: yiaL Funciton: Protein YiaL Locus tag: b3577 Name: yiaM Funciton: 2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM Locus tag: b3578 Name: yiaN Funciton: predicted transporter Locus tag: b3579 Name: yiaO Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor Locus tag: b3580 Name: lyxK Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-) Locus tag: b3581 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: b3582 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: b3583 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE	-175	4.1	AAGTGTGCCGTAGTTCACGATC	b3575
Salmonella typhimurium LT2
Position: -187 Score: 4.47277 Sequence: AAGTGTGTTGCAGTTCACGATA Locus tag: STM3668 Name: yiaK Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130) Locus tag: STM3669 Name: yiaL Funciton: Protein YiaL Locus tag: STM3670 Name: CKO_05035 Funciton: Putative chemotaxis protein, resembles cheA Locus tag: STM3671 Name: yiaM Funciton: 2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM Locus tag: STM3672 Name: yiaN Funciton: predicted transporter Locus tag: STM3673 Name: yiaO Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor Locus tag: STM3674 Name: lyxK Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-) Locus tag: STM3675 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: STM3676 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: STM3677 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-CKO_05035-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE	-187	4.5	AAGTGTGTTGCAGTTCACGATA	STM3668