Orthologous regulated operons containing yiaM gene
| Regulog: | Crp - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Carbon catabolism |
| Effector: | Cyclic 3',5'-AMP |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -175
Score: 4.10756 Sequence: AAGTGTGCCGTAGTTCACGATC
Locus tag: b3575
Name: yiaK Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130)
Locus tag: b3576
Name: yiaL Funciton: Protein YiaL
Locus tag: b3577
Name: yiaM Funciton: 2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM
Locus tag: b3578
Name: yiaN Funciton: predicted transporter
Locus tag: b3579
Name: yiaO Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor
Locus tag: b3580
Name: lyxK Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-)
Locus tag: b3581
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: b3582
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: b3583
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
| yiaK-yiaL-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE | -175 | 4.1 | AAGTGTGCCGTAGTTCACGATC | b3575 |
| Salmonella typhimurium LT2 | ||||
|
Position: -187
Score: 4.47277 Sequence: AAGTGTGTTGCAGTTCACGATA
Locus tag: STM3668
Name: yiaK Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130)
Locus tag: STM3669
Name: yiaL Funciton: Protein YiaL
Locus tag: STM3670
Name: CKO_05035 Funciton: Putative chemotaxis protein, resembles cheA
Locus tag: STM3671
Name: yiaM Funciton: 2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM
Locus tag: STM3672
Name: yiaN Funciton: predicted transporter
Locus tag: STM3673
Name: yiaO Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor
Locus tag: STM3674
Name: lyxK Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-)
Locus tag: STM3675
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: STM3676
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: STM3677
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
| yiaK-yiaL-CKO_05035-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE | -187 | 4.5 | AAGTGTGTTGCAGTTCACGATA | STM3668 |