Orthologous regulated operons containing ybhG gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -124 Score: 4.45604 Sequence: TTTTGTGACATACCGCATAAAT Locus tag: CKO_02331 Name: ybiH Funciton: putative transcriptional regulator Locus tag: CKO_02332 Name: ybhG Funciton: hypothetical protein Locus tag: CKO_02333 Name: ybhF Funciton: ABC transporter-related protein Locus tag: CKO_02334 Name: ybhS Funciton: ABC-2 type transporter Locus tag: CKO_02335 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-124	4.5	TTTTGTGACATACCGCATAAAT	CKO_02331
Enterobacter sp. 638
Position: -126 Score: 4.38474 Sequence: TTTTGTGACACGGCGCATAAAA Locus tag: Ent638_1287 Name: ybiH Funciton: putative transcriptional regulator Locus tag: Ent638_1286 Name: ybhG Funciton: hypothetical protein Locus tag: Ent638_1285 Name: ybhF Funciton: ABC transporter-related protein Locus tag: Ent638_1284 Name: ybhS Funciton: ABC-2 type transporter Locus tag: Ent638_1283 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-126	4.4	TTTTGTGACACGGCGCATAAAA	Ent638_1287
Escherichia coli str. K-12 substr. MG1655
Position: -123 Score: 4.52519 Sequence: TTTTGTGACGCAGCGCATAAAT Locus tag: b0796 Name: ybiH Funciton: putative transcriptional regulator Locus tag: b0795 Name: ybhG Funciton: hypothetical protein Locus tag: b0794 Name: ybhF Funciton: ABC transporter-related protein Locus tag: b0793 Name: ybhS Funciton: ABC-2 type transporter Locus tag: b0792 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-123	4.5	TTTTGTGACGCAGCGCATAAAT	b0796
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -224 Score: 3.58566 Sequence: AAATGAAACGGTATTCAAAAAA Position: -118 Score: 4.67089 Sequence: AATTGTTAAGCCCATCACAAAT Locus tag: KPN_00825 Name: KPN_00825 Funciton: putative bacterial regulatory protein, LysR Locus tag: KPN_00824 Name: ybiH Funciton: putative transcriptional regulator Locus tag: KPN_00823 Name: ybhG Funciton: hypothetical protein Locus tag: KPN_00822 Name: ybhF Funciton: ABC transporter-related protein Locus tag: KPN_00821 Name: ybhS Funciton: ABC-2 type transporter Locus tag: KPN_00820 Name: ybhR Funciton: ABC-2 type transporter
KPN_00825-ybiH-ybhG-ybhF-ybhS-ybhR	-224	3.6	AAATGAAACGGTATTCAAAAAA	KPN_00825
	-118	4.7	AATTGTTAAGCCCATCACAAAT
Proteus mirabilis HI4320
Position: -160 Score: 3.62258 Sequence: AATTTTTAAATAAATCATGTTT Locus tag: PMI0619 Name: ybiH Funciton: putative transcriptional regulator Locus tag: PMI0618 Name: ybhG Funciton: hypothetical protein Locus tag: PMI0617 Name: ybhF Funciton: ABC transporter-related protein Locus tag: PMI0616 Name: ybhS Funciton: ABC-2 type transporter Locus tag: PMI0615 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-160	3.6	AATTTTTAAATAAATCATGTTT	PMI0619
Salmonella typhimurium LT2
Position: -124 Score: 4.74352 Sequence: TTTTGTGATGCGGCGCATAAAT Locus tag: STM0819 Name: ybiH Funciton: putative transcriptional regulator Locus tag: STM0818 Name: ybhG Funciton: hypothetical protein Locus tag: STM0817 Name: ybhF Funciton: ABC transporter-related protein Locus tag: STM0816 Name: ybhS Funciton: ABC-2 type transporter Locus tag: STM0815 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-124	4.7	TTTTGTGATGCGGCGCATAAAT	STM0819
Serratia proteamaculans 568
Position: -146 Score: 4.57998 Sequence: TTAAGTGACGCAGAGCACAATA Locus tag: Spro_1330 Name: ybiH Funciton: putative transcriptional regulator Locus tag: Spro_1329 Name: ybhG Funciton: hypothetical protein Locus tag: Spro_1328 Name: ybhF Funciton: ABC transporter-related protein Locus tag: Spro_1327 Name: ybhS Funciton: ABC-2 type transporter Locus tag: Spro_1326 Name: ybhR Funciton: ABC-2 type transporter
ybiH-ybhG-ybhF-ybhS-ybhR	-146	4.6	TTAAGTGACGCAGAGCACAATA	Spro_1330

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing ybhG gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --