Orthologous regulated operons containing srlE gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -93 Score: 4.32968 Sequence: TTTTGAGATCAAAATAACACTT Locus tag: CKO_04056 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: CKO_04057 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: CKO_04058 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: CKO_04059 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: CKO_04060 Name: srlM Funciton: DNA-binding transcriptional activator of glucitol operon Locus tag: CKO_04061 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: CKO_04062 Name: srlQ Funciton: Glucitol operon SrlQ protein
srlA-srlE-srlB-srlD-srlM-srlR-srlQ	-93	4.3	TTTTGAGATCAAAATAACACTT	CKO_04056
Escherichia coli str. K-12 substr. MG1655
Position: -93 Score: 4.4359 Sequence: TTTTGCGATCAAAATAACACTT Locus tag: b2702 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: b2703 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: b2704 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: b2705 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: b2706 Name: srlM Funciton: DNA-binding transcriptional activator of glucitol operon Locus tag: b2707 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: b2708 Name: srlQ Funciton: Glucitol operon SrlQ protein
srlA-srlE-srlB-srlD-srlM-srlR-srlQ	-93	4.4	TTTTGCGATCAAAATAACACTT	b2702
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -92 Score: 4.57171 Sequence: TTTTGCGATCCATTTAACACTT Locus tag: KPN_03037 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: KPN_03038 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: KPN_03039 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: KPN_03040 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: KPN_03042 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: KPN_03043 Name: srlQ Funciton: Glucitol operon SrlQ protein
srlA-srlE-srlB-srlD-srlR-srlQ	-92	4.6	TTTTGCGATCCATTTAACACTT	KPN_03037
Salmonella typhimurium LT2
Position: -93 Score: 4.30886 Sequence: TTTTGCGATCACAATAACACTT Locus tag: STM2832 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: STM2833 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: STM2834 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: STM2835 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: STM2836 Name: srlM Funciton: DNA-binding transcriptional activator of glucitol operon Locus tag: STM2837 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: STM2838.S Name: srlQ Funciton: Glucitol operon SrlQ protein
srlA-srlE-srlB-srlD-srlM-srlR-srlQ	-93	4.3	TTTTGCGATCACAATAACACTT	STM2832
Serratia proteamaculans 568
Position: -110 Score: 4.88506 Sequence: AATTGTGATCTATTTAAAACAA Locus tag: Spro_3569 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: Spro_3570 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: Spro_3571 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: Spro_3572 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: Spro_3573 Name: srlM Funciton: DNA-binding transcriptional activator of glucitol operon Locus tag: Spro_3574 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: Spro_3575 Name: srlQ Funciton: Glucitol operon SrlQ protein
srlA-srlE-srlB-srlD-srlM-srlR-srlQ	-110	4.9	AATTGTGATCTATTTAAAACAA	Spro_3569