Orthologous regulated operons containing manZ gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Edwardsiella tarda EIB202
Position: -267 Score: 3.86081 Sequence: ATTAACGATGGGCGTCACATAA Locus tag: ETAE_1559 Name: manX Funciton: PTS enzyme IIAB, mannose-specific Locus tag: ETAE_1558 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: ETAE_1557 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: ETAE_1556 Name: yobD Funciton: hypothetical protein
manX-manY-manZ-yobD	-267	3.9	ATTAACGATGGGCGTCACATAA	ETAE_1559
Enterobacter sp. 638
Position: -166 Score: 3.81065 Sequence: ATTACGGATCTTCATCACATAA Locus tag: Ent638_2386 Name: manX Funciton: PTS enzyme IIAB, mannose-specific Locus tag: Ent638_2387 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: Ent638_2388 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: Ent638_2389 Name: yobD Funciton: hypothetical protein
manX-manY-manZ-yobD	-166	3.8	ATTACGGATCTTCATCACATAA	Ent638_2386
Escherichia coli str. K-12 substr. MG1655
Position: -60 Score: 3.80621 Sequence: TATTGTGTTGATTATCACTCAG Locus tag: b1818 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: b1819 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: b1820 Name: yobD Funciton: hypothetical protein
manY-manZ-yobD	-60	3.8	TATTGTGTTGATTATCACTCAG	b1818
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -163 Score: 3.79481 Sequence: TTAACGGATCTTCATCACATTA Locus tag: KPN_02333 Name: manX Funciton: PTS enzyme IIAB, mannose-specific Locus tag: KPN_02334 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: KPN_02335 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: KPN_02336 Name: yobD Funciton: hypothetical protein
manX-manY-manZ-yobD	-163	3.8	TTAACGGATCTTCATCACATTA	KPN_02333
Yersinia pestis KIM
Position: -231 Score: 3.8595 Sequence: ATAGATGAGCAATGTCACATAA Locus tag: y2551 Name: manX Funciton: PTS enzyme IIAB, mannose-specific Locus tag: y2552 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: y2553 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: y2554 Name: yobD Funciton: hypothetical protein
manX-manY-manZ-yobD	-231	3.9	ATAGATGAGCAATGTCACATAA	y2551