Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing manX gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Edwardsiella tarda EIB202
Position: -267
Score: 3.86081
Sequence: ATTAACGATGGGCGTCACATAA
Locus tag: ETAE_1559
Name: manX
Funciton: PTS enzyme IIAB, mannose-specific
Locus tag: ETAE_1558
Name: manY
Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit
Locus tag: ETAE_1557
Name: manZ
Funciton: PTS enzyme IID, mannose-specific
Locus tag: ETAE_1556
Name: yobD
Funciton: hypothetical protein
manX-manY-manZ-yobD -267 3.9 ATTAACGATGGGCGTCACATAA ETAE_1559
Enterobacter sp. 638
Position: -166
Score: 3.81065
Sequence: ATTACGGATCTTCATCACATAA
Locus tag: Ent638_2386
Name: manX
Funciton: PTS enzyme IIAB, mannose-specific
Locus tag: Ent638_2387
Name: manY
Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit
Locus tag: Ent638_2388
Name: manZ
Funciton: PTS enzyme IID, mannose-specific
Locus tag: Ent638_2389
Name: yobD
Funciton: hypothetical protein
manX-manY-manZ-yobD -166 3.8 ATTACGGATCTTCATCACATAA Ent638_2386
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -163
Score: 3.79481
Sequence: TTAACGGATCTTCATCACATTA
Locus tag: KPN_02333
Name: manX
Funciton: PTS enzyme IIAB, mannose-specific
Locus tag: KPN_02334
Name: manY
Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit
Locus tag: KPN_02335
Name: manZ
Funciton: PTS enzyme IID, mannose-specific
Locus tag: KPN_02336
Name: yobD
Funciton: hypothetical protein
manX-manY-manZ-yobD -163 3.8 TTAACGGATCTTCATCACATTA KPN_02333
Yersinia pestis KIM
Position: -231
Score: 3.8595
Sequence: ATAGATGAGCAATGTCACATAA
Locus tag: y2551
Name: manX
Funciton: PTS enzyme IIAB, mannose-specific
Locus tag: y2552
Name: manY
Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit
Locus tag: y2553
Name: manZ
Funciton: PTS enzyme IID, mannose-specific
Locus tag: y2554
Name: yobD
Funciton: hypothetical protein
manX-manY-manZ-yobD -231 3.9 ATAGATGAGCAATGTCACATAA y2551