Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lsrF gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -183
Score: 4.30528
Sequence: ATCTGTGATGGCAACCACAGTT
Locus tag: b1513
Name: lsrA
Funciton: ABC transporter related
Locus tag: b1514
Name: lsrC
Funciton: putative ABC transport system permease protein
Locus tag: b1515
Name: lsrD
Funciton: putative ABC transport system permease protein
Locus tag: b1516
Name: lsrB
Funciton: putative ABC superfamily (peri_perm), sugar transport protein
Locus tag: b1517
Name: lsrF
Funciton: hypothetical protein
Locus tag: b1518
Name: lsrG
Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG -183 4.3 ATCTGTGATGGCAACCACAGTT b1513
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -162
Score: 3.76441
Sequence: AAGTGTGAGCCGACTGGCAAAA
Locus tag: KPN_03507
Name: lsrA
Funciton: ABC transporter related
Locus tag: KPN_03506
Name: lsrC
Funciton: putative ABC transport system permease protein
Locus tag: KPN_03505
Name: lsrD
Funciton: putative ABC transport system permease protein
Locus tag: KPN_03504
Name: lsrB
Funciton: putative ABC superfamily (peri_perm), sugar transport protein
Locus tag: KPN_03503
Name: lsrF
Funciton: hypothetical protein
Locus tag: KPN_03502
Name: lsrG
Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG -162 3.8 AAGTGTGAGCCGACTGGCAAAA KPN_03507
Salmonella typhimurium LT2
Position: -185
Score: 3.99528
Sequence: AACCGTGATTAACGCCACAAAA
Position: -116
Score: 3.83065
Sequence: AAACGTGATCTGGATGAGAGTT
Locus tag: STM4074
Name: lsrA
Funciton: ABC transporter related
Locus tag: STM4075
Name: lsrC
Funciton: putative ABC transport system permease protein
Locus tag: STM4076
Name: lsrD
Funciton: putative ABC transport system permease protein
Locus tag: STM4077
Name: lsrB
Funciton: putative ABC superfamily (peri_perm), sugar transport protein
Locus tag: STM4078
Name: lsrF
Funciton: hypothetical protein
Locus tag: STM4079.S
Name: lsrG
Funciton: autoinducer-2 (AI-2) modifying protein LsrG
lsrA-lsrC-lsrD-lsrB-lsrF-lsrG -185 4 AACCGTGATTAACGCCACAAAA STM4074
-116 3.8 AAACGTGATCTGGATGAGAGTT