Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lacA gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -110
Score: 4.68084
Sequence: TAATGTGAGTTAGCTCACTCAT
Locus tag: b0344
Name: lacZ
Funciton: beta-D-galactosidase
Locus tag: b0343
Name: lacY
Funciton: galactoside permease
Locus tag: b0342
Name: lacA
Funciton: galactoside O-acetyltransferase
lacZ-lacY-lacA -110 4.7 TAATGTGAGTTAGCTCACTCAT b0344