Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing idnT gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -140
Score: 5.38043
Sequence: TAATGTGACATGTTTCACAAAT
Locus tag: CKO_02795
Name: idnD
Funciton: L-idonate 5-dehydrogenase
Locus tag: CKO_02793
Name: idnO
Funciton: 5-keto-D-gluconate-5-reductase
Locus tag: CKO_02792
Name: idnT
Funciton: L-idonate and D-gluconate transporter
Locus tag: CKO_02791
Name: idnR
Funciton: DNA-binding transcriptional repressor, 5-gluconate-binding
idnD-idnO-idnT-idnR -140 5.4 TAATGTGACATGTTTCACAAAT CKO_02795
Escherichia coli str. K-12 substr. MG1655
Position: -81
Score: 5.08567
Sequence: TGACGTGATCTTCATCACAAAT
Locus tag: b4267
Name: idnD
Funciton: L-idonate 5-dehydrogenase
Locus tag: b4266
Name: idnO
Funciton: 5-keto-D-gluconate-5-reductase
Locus tag: b4265
Name: idnT
Funciton: L-idonate and D-gluconate transporter
Locus tag: b4264
Name: idnR
Funciton: DNA-binding transcriptional repressor, 5-gluconate-binding
idnD-idnO-idnT-idnR -81 5.1 TGACGTGATCTTCATCACAAAT b4267
Salmonella typhimurium LT2
Position: -81
Score: 4.3085
Sequence: CAGCGTGACATAAGTCACAAAT
Locus tag: STM4484
Name: idnD
Funciton: L-idonate 5-dehydrogenase
Locus tag: STM4483
Name: idnO
Funciton: 5-keto-D-gluconate-5-reductase
Locus tag: STM4482
Name: idnT
Funciton: L-idonate and D-gluconate transporter
Locus tag: STM4481
Name: idnR
Funciton: DNA-binding transcriptional repressor, 5-gluconate-binding
idnD-idnO-idnT-idnR -81 4.3 CAGCGTGACATAAGTCACAAAT STM4484
© 2009-2020 RegPrecise