Orthologous regulated operons containing hemC gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -220 Score: 4.20432 Sequence: AAACGTGATCAATTTAACACCT Locus tag: CKO_00147 Name: hemC Funciton: porphobilinogen deaminase Locus tag: CKO_00146 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: CKO_00145 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: CKO_00144 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-220	4.2	AAACGTGATCAATTTAACACCT	CKO_00147
Edwardsiella tarda EIB202
Position: -205 Score: 4.20432 Sequence: AAACGTGATCAATTTAACACCT Locus tag: ETAE_0118 Name: hemC Funciton: porphobilinogen deaminase Locus tag: ETAE_0117 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: ETAE_0116 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: ETAE_0115 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-205	4.2	AAACGTGATCAATTTAACACCT	ETAE_0118
Enterobacter sp. 638
Position: -211 Score: 4.158 Sequence: AAACGTGATCAATCTAACACCT Locus tag: Ent638_3987 Name: hemC Funciton: porphobilinogen deaminase Locus tag: Ent638_3988 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: Ent638_3989 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: Ent638_3990 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-211	4.2	AAACGTGATCAATCTAACACCT	Ent638_3987
Escherichia coli str. K-12 substr. MG1655
Position: -236 Score: 4.20432 Sequence: AAACGTGATCAATTTAACACCT Locus tag: b3805 Name: hemC Funciton: porphobilinogen deaminase Locus tag: b3804 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: b3803 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: b3802 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-236	4.2	AAACGTGATCAATTTAACACCT	b3805
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -232 Score: 4.20432 Sequence: AAACGTGATCAATTTAACACCT Locus tag: KPN_04304 Name: hemC Funciton: porphobilinogen deaminase Locus tag: KPN_04303 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: KPN_04302 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: KPN_04301 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-232	4.2	AAACGTGATCAATTTAACACCT	KPN_04304
Salmonella typhimurium LT2
Position: -219 Score: 4.20432 Sequence: AAACGTGATCAATTTAACACCT Locus tag: STM3938 Name: hemC Funciton: porphobilinogen deaminase Locus tag: STM3937 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: STM3936 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: STM3935 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-219	4.2	AAACGTGATCAATTTAACACCT	STM3938
Serratia proteamaculans 568
Position: -223 Score: 4.158 Sequence: AAACGTGATCAATCTAACACCT Locus tag: Spro_0178 Name: hemC Funciton: porphobilinogen deaminase Locus tag: Spro_0177 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: Spro_0176 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: Spro_0175 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-223	4.2	AAACGTGATCAATCTAACACCT	Spro_0178

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing hemC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --