Orthologous regulated operons containing glnH2 gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -67 Score: 3.69887 Sequence: AAATGTTAACAAACACGCATAA Locus tag: CKO_02507 Name: glnH2 Funciton: glutamate and aspartate transporter subunit Locus tag: CKO_02509 Name: gltJ Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: CKO_02510 Name: gltK Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: CKO_02511 Name: gltL Funciton: ABC transporter-related protein
glnH2-gltJ-gltK-gltL	-67	3.7	AAATGTTAACAAACACGCATAA	CKO_02507
Enterobacter sp. 638
Position: -106 Score: 3.79951 Sequence: AAATGTTAACAAGCTTGCATAA Locus tag: Ent638_1182 Name: glnH2 Funciton: glutamate and aspartate transporter subunit Locus tag: Ent638_1181 Name: gltJ Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: Ent638_1180 Name: gltK Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: Ent638_1179 Name: gltL Funciton: ABC transporter-related protein
glnH2-gltJ-gltK-gltL	-106	3.8	AAATGTTAACAAGCTTGCATAA	Ent638_1182
Proteus mirabilis HI4320
Position: -142 Score: 3.9834 Sequence: TATTGAGAGATAGCTCTCGTAT Locus tag: PMI0437 Name: glnH2 Funciton: glutamate and aspartate transporter subunit Locus tag: PMI0436 Name: gltJ Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: PMI0435 Name: gltK Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: PMI0434 Name: gltL Funciton: ABC transporter-related protein
glnH2-gltJ-gltK-gltL	-142	4	TATTGAGAGATAGCTCTCGTAT	PMI0437
Salmonella typhimurium LT2
Position: -87 Score: 4.04829 Sequence: AAATGTTAACAAACACACATAA Locus tag: STM0665 Name: glnH2 Funciton: glutamate and aspartate transporter subunit Locus tag: STM0664 Name: gltJ Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: STM0663 Name: gltK Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: STM0662 Name: gltL Funciton: ABC transporter-related protein
glnH2-gltJ-gltK-gltL	-87	4	AAATGTTAACAAACACACATAA	STM0665
Yersinia pestis KIM
Position: -268 Score: 3.84963 Sequence: TGGTGCGATTCGTGTCTCAAAA Locus tag: y1189 Name: glnH2 Funciton: glutamate and aspartate transporter subunit Locus tag: y1188 Name: gltJ Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: y1187 Name: gltK Funciton: glutamate/aspartate ABC transporter, permease protein Locus tag: y1186 Name: gltL Funciton: ABC transporter-related protein
glnH2-gltJ-gltK-gltL	-268	3.8	TGGTGCGATTCGTGTCTCAAAA	y1189