Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing garR gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Enterobacter sp. 638
Position: -291
Score: 4.71677
Sequence: AAATGTGATCAAGATCACCCCT
Locus tag: Ent638_3569
Name: garP
Funciton: d-galactonate transporter
Locus tag: Ent638_3568
Name: garL
Funciton: alpha-dehydro-beta-deoxy-D-glucarate aldolase
Locus tag: Ent638_3567
Name: garR
Funciton: tartronate semialdehyde reductase
Locus tag: Ent638_3566
Name: garK
Funciton: glycerate kinase I
garP-garL-garR-garK -291 4.7 AAATGTGATCAAGATCACCCCT Ent638_3569
Escherichia coli str. K-12 substr. MG1655
Position: -269
Score: 4.35243
Sequence: AAATGTGATCAATGTCAATCAT
Locus tag: b3127
Name: garP
Funciton: d-galactonate transporter
Locus tag: b3126
Name: garL
Funciton: alpha-dehydro-beta-deoxy-D-glucarate aldolase
Locus tag: b3125
Name: garR
Funciton: tartronate semialdehyde reductase
Locus tag: b3124
Name: garK
Funciton: glycerate kinase I
garP-garL-garR-garK -269 4.4 AAATGTGATCAATGTCAATCAT b3127
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -289
Score: 4.48682
Sequence: AAATGTGATCGGCATCACTCCT
Locus tag: KPN_03539
Name: garP
Funciton: d-galactonate transporter
Locus tag: KPN_03538
Name: garL
Funciton: alpha-dehydro-beta-deoxy-D-glucarate aldolase
Locus tag: KPN_03537
Name: garR
Funciton: tartronate semialdehyde reductase
Locus tag: KPN_03536
Name: garK
Funciton: glycerate kinase I
garP-garL-garR-garK -289 4.5 AAATGTGATCGGCATCACTCCT KPN_03539
© 2009-2020 RegPrecise