Orthologous regulated operons containing fucR gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -207 Score: 4.8944 Sequence: TAAAGTGATGGTAGTCACATAA Position: -167 Score: 4.46422 Sequence: AAGTGTGACCGCCGTCATATTA Locus tag: b2801 Name: fucP Funciton: L-fucose permease Locus tag: b2802 Name: fucI Funciton: L-fucose isomerase Locus tag: b2803 Name: fucK Funciton: L-fuculokinase Locus tag: b2804 Name: fucU Funciton: conserved protein of fucose operon Locus tag: b2805 Name: fucR Funciton: DNA-binding transcriptional activator
fucP-fucI-fucK-fucU-fucR	-207	4.9	TAAAGTGATGGTAGTCACATAA	b2801
	-167	4.5	AAGTGTGACCGCCGTCATATTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -260 Score: 4.693 Sequence: TAAAGTGACAATAATCACATAA Position: -220 Score: 4.6082 Sequence: AAGTGTGACCATCATCATATTA Locus tag: KPN_03152 Name: fucP Funciton: L-fucose permease Locus tag: KPN_03153 Name: fucI Funciton: L-fucose isomerase Locus tag: KPN_03154 Name: fucK Funciton: L-fuculokinase Locus tag: KPN_03155 Name: fucU Funciton: conserved protein of fucose operon Locus tag: KPN_03156 Name: fucR Funciton: DNA-binding transcriptional activator
fucP-fucI-fucK-fucU-fucR	-260	4.7	TAAAGTGACAATAATCACATAA	KPN_03152
	-220	4.6	AAGTGTGACCATCATCATATTA
Salmonella typhimurium LT2
Position: -207 Score: 4.72061 Sequence: TAAAGTGATGATAATCACAGAA Position: -167 Score: 4.88579 Sequence: AAATGTGACCGCCATCATATTA Locus tag: STM2975 Name: fucP Funciton: L-fucose permease Locus tag: STM2976 Name: fucI Funciton: L-fucose isomerase Locus tag: STM2977 Name: fucK Funciton: L-fuculokinase Locus tag: STM2978 Name: fucU Funciton: conserved protein of fucose operon Locus tag: STM2979 Name: fucR Funciton: DNA-binding transcriptional activator
fucP-fucI-fucK-fucU-fucR	-207	4.7	TAAAGTGATGATAATCACAGAA	STM2975
	-167	4.9	AAATGTGACCGCCATCATATTA