Orthologous regulated operons containing PMI2649 gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -215 Score: 4.11549 Sequence: ATTGGTGATCCATAAAACAATA Position: -158 Score: 4.04512 Sequence: ATTGGTGAGGAACTTAACAATA Locus tag: b0041 Name: fixA Funciton: electron transfer flavoprotein, beta subunit Locus tag: b0042 Name: PMI2649 Funciton: predicted electron transfer flavoprotein, NAD/FAD-binding domain and ETFP adenine nucleotide-binding domain-like Locus tag: b0043 Name: fixC Funciton: predicted oxidoreductase with FAD/NAD(P)-binding domain Locus tag: b0044 Name: fixX Funciton: ferredoxin-like protein Locus tag: b0045 Name: yaaU Funciton: predicted transporter
fixA-PMI2649-fixC-fixX-yaaU	-215	4.1	ATTGGTGATCCATAAAACAATA	b0041
	-158	4	ATTGGTGAGGAACTTAACAATA
Proteus mirabilis HI4320
Position: -216 Score: 4.27648 Sequence: ATTGTTGATCCAGATAACAATA Position: -157 Score: 4.30109 Sequence: ATTGGTGATGTATTTAGCAATA Position: -98 Score: 3.99615 Sequence: ATTGGTGATCTAGATTTAATTT Locus tag: PMI2653 Name: fixA Funciton: electron transfer flavoprotein, beta subunit Locus tag: PMI2652 Name: fixB Funciton: electron transfer flavoprotein alpha subunit for carnitine metabolism Locus tag: PMI2651 Name: fixC Funciton: FAD-dependent oxidoreductase subunit for carnitine metabolism Locus tag: PMI2650 Name: fixX Funciton: ferredoxin-like protein Locus tag: PMI2649 Name: PMI2649 Funciton: MFS-family transporter
fixA-fixB-fixC-fixX-PMI2649	-216	4.3	ATTGTTGATCCAGATAACAATA	PMI2653
	-157	4.3	ATTGGTGATGTATTTAGCAATA
	-98	4	ATTGGTGATCTAGATTTAATTT