Orthologous regulated operons containing dppF gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -121 Score: 3.79433 Sequence: TTATGTGAACGGAATCCCCATC Locus tag: CKO_04994 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: CKO_04993 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: CKO_04992 Name: dppC Funciton: dipeptide transporter Locus tag: CKO_04991 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: CKO_04990 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
dppA-dppB-dppC-dppD-dppF	-121	3.8	TTATGTGAACGGAATCCCCATC	CKO_04994
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -62 Score: 4.00634 Sequence: ATATGCAAACAACATCACAATT Locus tag: KPN_03899 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: KPN_03898 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: KPN_03897 Name: dppC Funciton: dipeptide transporter Locus tag: KPN_03896 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: KPN_03895 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
dppA-dppB-dppC-dppD-dppF	-62	4	ATATGCAAACAACATCACAATT	KPN_03899
Photorhabdus luminescens subsp. laumondii TTO1
Position: -223 Score: 3.66575 Sequence: AAATGTGCGCATTGTCATGTTT Locus tag: plu0300 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: plu0301 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: plu0302 Name: dppC Funciton: dipeptide transporter Locus tag: plu0303 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: plu0304 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
dppA-dppB-dppC-dppD-dppF	-223	3.7	AAATGTGCGCATTGTCATGTTT	plu0300
Serratia proteamaculans 568
Position: -271 Score: 3.78683 Sequence: TTGTTTGCTGTTTCTCACAGTC Locus tag: Spro_0138 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: Spro_0139 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: Spro_0140 Name: dppC Funciton: dipeptide transporter Locus tag: Spro_0141 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: Spro_0142 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
dppA-dppB-dppC-dppD-dppF	-271	3.8	TTGTTTGCTGTTTCTCACAGTC	Spro_0138
Yersinia pestis KIM
Position: -211 Score: 3.92758 Sequence: AGATGTGAGCCATATAACCTCT Locus tag: y3825 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: y3826 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: y3828 Name: dppC Funciton: dipeptide transporter Locus tag: y3829 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: y3830 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
dppA-dppB-dppC-dppD-dppF	-211	3.9	AGATGTGAGCCATATAACCTCT	y3825