Orthologous regulated operons containing ybgT gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -300 Score: 3.62694 Sequence: TAAATTGTTCTCGATCAAATTG Position: -255 Score: 3.625 Sequence: TAAATTGATCACCGTCGAAAAA Locus tag: b0733 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: b0734 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: b4515 Name: ybgT Funciton: hypothetical protein Locus tag: b0735 Name: ybgE Funciton: hypothetical protein
cydA-cydB-ybgT-ybgE	-300	3.6	TAAATTGTTCTCGATCAAATTG	b0733
	-255	3.6	TAAATTGATCACCGTCGAAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -252 Score: 3.64742 Sequence: TATATTGATCACCGTCGAAAAA Locus tag: KPN_00736 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: KPN_00737 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: KPN_00738 Name: ybgT Funciton: hypothetical protein Locus tag: KPN_00739 Name: ybgE Funciton: hypothetical protein
cydA-cydB-ybgT-ybgE	-252	3.6	TATATTGATCACCGTCGAAAAA	KPN_00736
Proteus mirabilis HI4320
Position: -247 Score: 3.76546 Sequence: AAATATGCTGTTACTAACCTAA Locus tag: PMI0573 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: PMI0574 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: PMI0575 Name: ybgT Funciton: hypothetical protein Locus tag: PMI0576 Name: ybgE Funciton: hypothetical protein
cydA-cydB-ybgT-ybgE	-247	3.8	AAATATGCTGTTACTAACCTAA	PMI0573
Salmonella typhimurium LT2
Position: -256 Score: 3.72571 Sequence: TAAATTGATCGCTGTCGAAAAA Locus tag: STM0740 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: STM0741 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: STM0742 Name: ybgT Funciton: hypothetical protein Locus tag: STM0743 Name: ybgE Funciton: hypothetical protein
cydA-cydB-ybgT-ybgE	-256	3.7	TAAATTGATCGCTGTCGAAAAA	STM0740
Serratia proteamaculans 568
Position: -300 Score: 3.67893 Sequence: AAGTCTAACCCACATCACGTAA Locus tag: Spro_1271 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: Spro_1272 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: Spro_1273 Name: ybgT Funciton: hypothetical protein Locus tag: Spro_1274 Name: ybgE Funciton: hypothetical protein
cydA-cydB-ybgT-ybgE	-300	3.7	AAGTCTAACCCACATCACGTAA	Spro_1271