Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing creC gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -81
Score: 3.72731
Sequence: TATTGAGATTTTGTTCTTAATC
Locus tag: b4397
Name: creA
Funciton: hypothetical protein
Locus tag: b4398
Name: creB
Funciton: DNA-binding response regulator CreB
Locus tag: b4399
Name: creC
Funciton: sensory histidine kinase CreC
Locus tag: b4400
Name: creD
Funciton: tolerance to colicin E2
creA-creB-creC-creD -81 3.7 TATTGAGATTTTGTTCTTAATC b4397
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -42
Score: 3.76777
Sequence: TTTTTTAATAATGGTAACAATA
Locus tag: KPN_04852
Name: creA
Funciton: hypothetical protein
Locus tag: KPN_04853
Name: creB
Funciton: DNA-binding response regulator CreB
Locus tag: KPN_04854
Name: creC
Funciton: sensory histidine kinase CreC
Locus tag: KPN_04855
Name: creD
Funciton: tolerance to colicin E2
creA-creB-creC-creD -42 3.8 TTTTTTAATAATGGTAACAATA KPN_04852
© 2009-2020 RegPrecise