Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CKO_05007 gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -95
Score: 4.4346
Sequence: CTTCGTGATGGTGATCATAATT
Locus tag: CKO_05006
Name: CKO_05006
Funciton: Xylose isomerase domain protein TIM barrel
Locus tag: CKO_05007
Name: CKO_05007
Funciton: PfkB domain protein
Locus tag: CKO_05008
Name: CKO_05008
Funciton: major facilitator superfamily MFS_1
Locus tag: CKO_05009
Name: tkrA
Funciton: 2-hydroxyacid dehydrogenase
CKO_05006-CKO_05007-CKO_05008-tkrA -95 4.4 CTTCGTGATGGTGATCATAATT CKO_05006
Enterobacter sp. 638
Position: -97
Score: 4.41954
Sequence: CTTCGTGATGGCGATCATAAAT
Locus tag: Ent638_0170
Name: CKO_05006
Funciton: Xylose isomerase domain protein TIM barrel
Locus tag: Ent638_0169
Name: CKO_05007
Funciton: PfkB domain protein
Locus tag: Ent638_0168
Name: CKO_05008
Funciton: major facilitator superfamily MFS_1
Locus tag: Ent638_0167
Name: tkrA
Funciton: 2-hydroxyacid dehydrogenase
CKO_05006-CKO_05007-CKO_05008-tkrA -97 4.4 CTTCGTGATGGCGATCATAAAT Ent638_0170
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -106
Score: 4.48251
Sequence: CTTCGTGATGCCGATCATAAAT
Locus tag: KPN_03912
Name: CKO_05006
Funciton: Xylose isomerase domain protein TIM barrel
Locus tag: KPN_03913
Name: CKO_05007
Funciton: PfkB domain protein
Locus tag: KPN_03914
Name: CKO_05008
Funciton: major facilitator superfamily MFS_1
Locus tag: KPN_03915
Name: tkrA
Funciton: 2-hydroxyacid dehydrogenase
CKO_05006-CKO_05007-CKO_05008-tkrA -106 4.5 CTTCGTGATGCCGATCATAAAT KPN_03912
Serratia proteamaculans 568
Position: -110
Score: 3.9455
Sequence: GTTCGTGACTGCGATCATATTT
Locus tag: Spro_0060
Name: CKO_05006
Funciton: Xylose isomerase domain protein TIM barrel
Locus tag: Spro_0059
Name: CKO_05007
Funciton: PfkB domain protein
Locus tag: Spro_0058
Name: CKO_05008
Funciton: major facilitator superfamily MFS_1
Locus tag: Spro_0057
Name: tkrA
Funciton: 2-hydroxyacid dehydrogenase
CKO_05006-CKO_05007-CKO_05008-tkrA -110 3.9 GTTCGTGACTGCGATCATATTT Spro_0060