Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing chbF gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -188
Score: 4.09114
Sequence: AAATGTGAGAGGGGTCATAACA
Locus tag: CKO_01763
Name: chbB
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Locus tag: CKO_01762
Name: chbC
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component
Locus tag: CKO_01761
Name: chbA
Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
Locus tag: CKO_01760
Name: chbR
Funciton: DNA-binding transcriptional dual regulator
Locus tag: CKO_01759
Name: chbF
Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
Locus tag: CKO_01758
Name: chbG
Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG -188 4.1 AAATGTGAGAGGGGTCATAACA CKO_01763
Enterobacter sp. 638
Position: -129
Score: 3.87545
Sequence: AATTTTGATTAACCGCGAATTA
Locus tag: Ent638_1706
Name: chbB
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Locus tag: Ent638_1707
Name: chbC
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component
Locus tag: Ent638_1708
Name: chbA
Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
Locus tag: Ent638_1709
Name: chbR
Funciton: DNA-binding transcriptional dual regulator
Locus tag: Ent638_1710
Name: chbF
Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
Locus tag: Ent638_1711
Name: chbG
Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG -129 3.9 AATTTTGATTAACCGCGAATTA Ent638_1706
Escherichia coli str. K-12 substr. MG1655
Position: -201
Score: 3.67998
Sequence: AAATGTGAAGAGGGTCATAACC
Locus tag: b1738
Name: chbB
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Locus tag: b1737
Name: chbC
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component
Locus tag: b1736
Name: chbA
Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
Locus tag: b1735
Name: chbR
Funciton: DNA-binding transcriptional dual regulator
Locus tag: b1734
Name: chbF
Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
Locus tag: b1733
Name: chbG
Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG -201 3.7 AAATGTGAAGAGGGTCATAACC b1738
Salmonella typhimurium LT2
Position: -250
Score: 3.9185
Sequence: TTTTGTGCCTGCCATAACCTTA
Position: -203
Score: 3.85514
Sequence: AAATGTGAGGGGGGTCATAACG
Locus tag: STM1312
Name: chbB
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Locus tag: STM1313
Name: chbC
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component
Locus tag: STM1314
Name: chbA
Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
Locus tag: STM1315
Name: chbR
Funciton: DNA-binding transcriptional dual regulator
Locus tag: STM1316
Name: chbF
Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
Locus tag: STM1317
Name: chbG
Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG -250 3.9 TTTTGTGCCTGCCATAACCTTA STM1312
-203 3.9 AAATGTGAGGGGGGTCATAACG
Serratia proteamaculans 568
Position: -177
Score: 4.6246
Sequence: ATTTGCGAGACAGATCACACTA
Position: -143
Score: 3.61214
Sequence: AAATGTGAAGAGGGTCAATCAG
Locus tag: Spro_0834
Name: chbB
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Locus tag: Spro_0835
Name: chbC
Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component
Locus tag: Spro_0836
Name: chbF
Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
Locus tag: Spro_0837
Name: chbR
Funciton: DNA-binding transcriptional dual regulator
Locus tag: Spro_0838
Name: ydjC
Funciton: hypothetical protein
chbB-chbC-chbF-chbR-ydjC -177 4.6 ATTTGCGAGACAGATCACACTA Spro_0834
-143 3.6 AAATGTGAAGAGGGTCAATCAG