Orthologous regulated operons containing chbA gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -188 Score: 4.09114 Sequence: AAATGTGAGAGGGGTCATAACA Locus tag: CKO_01763 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: CKO_01762 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: CKO_01761 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: CKO_01760 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: CKO_01759 Name: chbF Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase) Locus tag: CKO_01758 Name: chbG Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG	-188	4.1	AAATGTGAGAGGGGTCATAACA	CKO_01763
Enterobacter sp. 638
Position: -129 Score: 3.87545 Sequence: AATTTTGATTAACCGCGAATTA Locus tag: Ent638_1706 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: Ent638_1707 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: Ent638_1708 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: Ent638_1709 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: Ent638_1710 Name: chbF Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase) Locus tag: Ent638_1711 Name: chbG Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG	-129	3.9	AATTTTGATTAACCGCGAATTA	Ent638_1706
Escherichia coli str. K-12 substr. MG1655
Position: -201 Score: 3.67998 Sequence: AAATGTGAAGAGGGTCATAACC Locus tag: b1738 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: b1737 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: b1736 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: b1735 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: b1734 Name: chbF Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase) Locus tag: b1733 Name: chbG Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG	-201	3.7	AAATGTGAAGAGGGTCATAACC	b1738
Salmonella typhimurium LT2
Position: -250 Score: 3.9185 Sequence: TTTTGTGCCTGCCATAACCTTA Position: -203 Score: 3.85514 Sequence: AAATGTGAGGGGGGTCATAACG Locus tag: STM1312 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: STM1313 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: STM1314 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: STM1315 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: STM1316 Name: chbF Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase) Locus tag: STM1317 Name: chbG Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbF-chbG	-250	3.9	TTTTGTGCCTGCCATAACCTTA	STM1312
	-203	3.9	AAATGTGAGGGGGGTCATAACG
Yersinia pestis KIM
Position: -214 Score: 4.50878 Sequence: TTTTGCGATAACCATCACATTG Locus tag: y1251 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: y1252 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: y1253 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: y1254 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: y1255 Name: chbG Funciton: hypothetical protein
chbB-chbC-chbA-chbR-chbG	-214	4.5	TTTTGCGATAACCATCACATTG	y1251