Orthologous regulated operons containing atpC gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -262 Score: 4.70779 Sequence: ATATGTGATCCGAAGCACGCTT Locus tag: CKO_00079 Name: atpI Funciton: ATP synthase subunit I Locus tag: CKO_00078 Name: atpB Funciton: ATP synthase subunit A Locus tag: CKO_00077 Name: atpE Funciton: ATP synthase subunit C Locus tag: CKO_00076 Name: atpF Funciton: ATP synthase subunit B Locus tag: CKO_00075 Name: atpH Funciton: ATP synthase subunit D Locus tag: CKO_00073 Name: atpA Funciton: ATP synthase subunit A Locus tag: CKO_00071 Name: atpG Funciton: ATP synthase subunit C Locus tag: CKO_00070 Name: atpD Funciton: ATP synthase subunit B Locus tag: CKO_00069 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-262	4.7	ATATGTGATCCGAAGCACGCTT	CKO_00079
Edwardsiella tarda EIB202
Position: -297 Score: 3.72882 Sequence: AATCGTGAAAATATTTAAATTA Locus tag: ETAE_3526 Name: atpI Funciton: ATP synthase subunit I Locus tag: ETAE_3527 Name: atpB Funciton: ATP synthase subunit A Locus tag: ETAE_3528 Name: atpE Funciton: ATP synthase subunit C Locus tag: ETAE_3529 Name: atpF Funciton: ATP synthase subunit B Locus tag: ETAE_3530 Name: atpH Funciton: ATP synthase subunit D Locus tag: ETAE_3531 Name: atpA Funciton: ATP synthase subunit A Locus tag: ETAE_3532 Name: atpG Funciton: ATP synthase subunit C Locus tag: ETAE_3533 Name: atpD Funciton: ATP synthase subunit B Locus tag: ETAE_3534 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-297	3.7	AATCGTGAAAATATTTAAATTA	ETAE_3526
Enterobacter sp. 638
Position: -261 Score: 4.79394 Sequence: TTTTGTGATCTCGTGCACGCTT Locus tag: Ent638_4125 Name: atpI Funciton: ATP synthase subunit I Locus tag: Ent638_4126 Name: atpB Funciton: ATP synthase subunit A Locus tag: Ent638_4127 Name: atpE Funciton: ATP synthase subunit C Locus tag: Ent638_4128 Name: atpF Funciton: ATP synthase subunit B Locus tag: Ent638_4129 Name: atpH Funciton: ATP synthase subunit D Locus tag: Ent638_4130 Name: atpA Funciton: ATP synthase subunit A Locus tag: Ent638_4131 Name: atpG Funciton: ATP synthase subunit C Locus tag: Ent638_4132 Name: atpD Funciton: ATP synthase subunit B Locus tag: Ent638_4133 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-261	4.8	TTTTGTGATCTCGTGCACGCTT	Ent638_4125
Erwinia amylovora ATCC 49946
Position: -264 Score: 4.38819 Sequence: ATTTGTGATCGTGGACACGCTT Locus tag: EAM_3481 Name: atpI Funciton: ATP synthase subunit I Locus tag: EAM_3480 Name: atpB Funciton: ATP synthase subunit A Locus tag: EAM_3479 Name: atpE Funciton: ATP synthase subunit C Locus tag: EAM_3478 Name: atpF Funciton: ATP synthase subunit B Locus tag: EAM_3477 Name: atpH Funciton: ATP synthase subunit D Locus tag: EAM_3476 Name: atpA Funciton: ATP synthase subunit A Locus tag: EAM_3475 Name: atpG Funciton: ATP synthase subunit C Locus tag: EAM_3474 Name: atpD Funciton: ATP synthase subunit B Locus tag: EAM_3473 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-264	4.4	ATTTGTGATCGTGGACACGCTT	EAM_3481
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -254 Score: 5.00697 Sequence: TTATGTGAGTCACATCACAGAT Locus tag: ECA4519 Name: atpI Funciton: ATP synthase subunit I Locus tag: ECA4518 Name: atpB Funciton: ATP synthase subunit A Locus tag: ECA4517 Name: atpE Funciton: ATP synthase subunit C Locus tag: ECA4516 Name: atpF Funciton: ATP synthase subunit B Locus tag: ECA4515 Name: atpH Funciton: ATP synthase subunit D Locus tag: ECA4514 Name: atpA Funciton: ATP synthase subunit A Locus tag: ECA4513 Name: atpG Funciton: ATP synthase subunit C Locus tag: ECA4512 Name: atpD Funciton: ATP synthase subunit B Locus tag: ECA4511 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-254	5	TTATGTGAGTCACATCACAGAT	ECA4519
Escherichia coli str. K-12 substr. MG1655
Position: -263 Score: 4.79693 Sequence: ATATGTGATCTGAAGCACGCTT Locus tag: b3739 Name: atpI Funciton: ATP synthase subunit I Locus tag: b3738 Name: atpB Funciton: ATP synthase subunit A Locus tag: b3737 Name: atpE Funciton: ATP synthase subunit C Locus tag: b3736 Name: atpF Funciton: ATP synthase subunit B Locus tag: b3735 Name: atpH Funciton: ATP synthase subunit D Locus tag: b3734 Name: atpA Funciton: ATP synthase subunit A Locus tag: b3733 Name: atpG Funciton: ATP synthase subunit C Locus tag: b3732 Name: atpD Funciton: ATP synthase subunit B Locus tag: b3731 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-263	4.8	ATATGTGATCTGAAGCACGCTT	b3739
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -262 Score: 4.74828 Sequence: TTATGTGATCTGATGCACGCTT Locus tag: KPN_04144 Name: atpI Funciton: ATP synthase subunit I Locus tag: KPN_04143 Name: atpB Funciton: ATP synthase subunit A Locus tag: KPN_04142 Name: atpE Funciton: ATP synthase subunit C Locus tag: KPN_04141 Name: atpF Funciton: ATP synthase subunit B Locus tag: KPN_04140 Name: atpH Funciton: ATP synthase subunit D Locus tag: KPN_04139 Name: atpA Funciton: ATP synthase subunit A Locus tag: KPN_04138 Name: atpG Funciton: ATP synthase subunit C Locus tag: KPN_04137 Name: atpD Funciton: ATP synthase subunit B Locus tag: KPN_04136 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-262	4.7	TTATGTGATCTGATGCACGCTT	KPN_04144
Photorhabdus luminescens subsp. laumondii TTO1
Position: -265 Score: 5.72401 Sequence: TTATGTGATTTAAATCACATTT Locus tag: plu0047 Name: atpI Funciton: ATP synthase subunit I Locus tag: plu0046 Name: atpB Funciton: ATP synthase subunit A Locus tag: plu0045 Name: atpE Funciton: ATP synthase subunit C Locus tag: plu0044 Name: atpF Funciton: ATP synthase subunit B Locus tag: plu0043 Name: atpH Funciton: ATP synthase subunit D Locus tag: plu0042 Name: atpA Funciton: ATP synthase subunit A Locus tag: plu0041 Name: atpG Funciton: ATP synthase subunit C Locus tag: plu0040 Name: atpD Funciton: ATP synthase subunit B Locus tag: plu0039 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-265	5.7	TTATGTGATTTAAATCACATTT	plu0047
Proteus mirabilis HI4320
Position: -259 Score: 5.04378 Sequence: TTGTGTGTTCTAGATCACATTA Locus tag: PMI3057 Name: atpI Funciton: ATP synthase subunit I Locus tag: PMI3058 Name: atpB Funciton: ATP synthase subunit A Locus tag: PMI3059 Name: atpE Funciton: ATP synthase subunit C Locus tag: PMI3060 Name: atpF Funciton: ATP synthase subunit B Locus tag: PMI3061 Name: atpH Funciton: ATP synthase subunit D Locus tag: PMI3062 Name: atpA Funciton: ATP synthase subunit A Locus tag: PMI3063 Name: atpG Funciton: ATP synthase subunit C Locus tag: PMI3064 Name: atpD Funciton: ATP synthase subunit B Locus tag: PMI3065 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-259	5	TTGTGTGTTCTAGATCACATTA	PMI3057
Salmonella typhimurium LT2
Position: -262 Score: 4.64922 Sequence: ATGTGTGATCTGGTGCACGCTT Position: -211 Score: 4.05602 Sequence: TTTTGTACGATCGTTCACACTT Locus tag: STM3872 Name: atpI Funciton: ATP synthase subunit I Locus tag: STM3871 Name: atpB Funciton: ATP synthase subunit A Locus tag: STM3870 Name: atpE Funciton: ATP synthase subunit C Locus tag: STM3869 Name: atpF Funciton: ATP synthase subunit B Locus tag: STM3868 Name: atpH Funciton: ATP synthase subunit D Locus tag: STM3867 Name: atpA Funciton: ATP synthase subunit A Locus tag: STM3866 Name: atpG Funciton: ATP synthase subunit C Locus tag: STM3865 Name: atpD Funciton: ATP synthase subunit B Locus tag: STM3864 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-262	4.6	ATGTGTGATCTGGTGCACGCTT	STM3872
	-211	4.1	TTTTGTACGATCGTTCACACTT
Serratia proteamaculans 568
Position: -265 Score: 4.38999 Sequence: TATTGTGAGCAACTACACGTTT Locus tag: Spro_0001 Name: atpI Funciton: ATP synthase subunit I Locus tag: Spro_0002 Name: atpB Funciton: ATP synthase subunit A Locus tag: Spro_0003 Name: atpE Funciton: ATP synthase subunit C Locus tag: Spro_0004 Name: atpF Funciton: ATP synthase subunit B Locus tag: Spro_0005 Name: atpH Funciton: ATP synthase subunit D Locus tag: Spro_0006 Name: atpA Funciton: ATP synthase subunit A Locus tag: Spro_0007 Name: atpG Funciton: ATP synthase subunit C Locus tag: Spro_0008 Name: atpD Funciton: ATP synthase subunit B Locus tag: Spro_0009 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-265	4.4	TATTGTGAGCAACTACACGTTT	Spro_0001
Yersinia pestis KIM
Position: -263 Score: 5.42488 Sequence: TTATGTGATGTATTTCACGTTT Locus tag: y4142 Name: atpI Funciton: ATP synthase subunit I Locus tag: y4141 Name: atpB Funciton: ATP synthase subunit A Locus tag: y4140 Name: atpE Funciton: ATP synthase subunit C Locus tag: y4139 Name: atpF Funciton: ATP synthase subunit B Locus tag: y4138 Name: atpH Funciton: ATP synthase subunit D Locus tag: y4137 Name: atpA Funciton: ATP synthase subunit A Locus tag: y4136 Name: atpG Funciton: ATP synthase subunit C Locus tag: y4135 Name: atpD Funciton: ATP synthase subunit B Locus tag: y4134 Name: atpC Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC	-263	5.4	TTATGTGATGTATTTCACGTTT	y4142

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing atpC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --