Orthologous regulated operons containing atpD gene
Regulog: | Crp - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | CRP |
Regulation mode: | activator (repressor) |
Biological process: | Carbon catabolism |
Effector: | Cyclic 3',5'-AMP |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Citrobacter koseri ATCC BAA-895 | ||||
Position: -262
Score: 4.70779 Sequence: ATATGTGATCCGAAGCACGCTT
Locus tag: CKO_00079
Name: atpI Funciton: ATP synthase subunit I
Locus tag: CKO_00078
Name: atpB Funciton: ATP synthase subunit A
Locus tag: CKO_00077
Name: atpE Funciton: ATP synthase subunit C
Locus tag: CKO_00076
Name: atpF Funciton: ATP synthase subunit B
Locus tag: CKO_00075
Name: atpH Funciton: ATP synthase subunit D
Locus tag: CKO_00073
Name: atpA Funciton: ATP synthase subunit A
Locus tag: CKO_00071
Name: atpG Funciton: ATP synthase subunit C
Locus tag: CKO_00070
Name: atpD Funciton: ATP synthase subunit B
Locus tag: CKO_00069
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -262 | 4.7 | ATATGTGATCCGAAGCACGCTT | CKO_00079 |
Edwardsiella tarda EIB202 | ||||
Position: -297
Score: 3.72882 Sequence: AATCGTGAAAATATTTAAATTA
Locus tag: ETAE_3526
Name: atpI Funciton: ATP synthase subunit I
Locus tag: ETAE_3527
Name: atpB Funciton: ATP synthase subunit A
Locus tag: ETAE_3528
Name: atpE Funciton: ATP synthase subunit C
Locus tag: ETAE_3529
Name: atpF Funciton: ATP synthase subunit B
Locus tag: ETAE_3530
Name: atpH Funciton: ATP synthase subunit D
Locus tag: ETAE_3531
Name: atpA Funciton: ATP synthase subunit A
Locus tag: ETAE_3532
Name: atpG Funciton: ATP synthase subunit C
Locus tag: ETAE_3533
Name: atpD Funciton: ATP synthase subunit B
Locus tag: ETAE_3534
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -297 | 3.7 | AATCGTGAAAATATTTAAATTA | ETAE_3526 |
Enterobacter sp. 638 | ||||
Position: -261
Score: 4.79394 Sequence: TTTTGTGATCTCGTGCACGCTT
Locus tag: Ent638_4125
Name: atpI Funciton: ATP synthase subunit I
Locus tag: Ent638_4126
Name: atpB Funciton: ATP synthase subunit A
Locus tag: Ent638_4127
Name: atpE Funciton: ATP synthase subunit C
Locus tag: Ent638_4128
Name: atpF Funciton: ATP synthase subunit B
Locus tag: Ent638_4129
Name: atpH Funciton: ATP synthase subunit D
Locus tag: Ent638_4130
Name: atpA Funciton: ATP synthase subunit A
Locus tag: Ent638_4131
Name: atpG Funciton: ATP synthase subunit C
Locus tag: Ent638_4132
Name: atpD Funciton: ATP synthase subunit B
Locus tag: Ent638_4133
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -261 | 4.8 | TTTTGTGATCTCGTGCACGCTT | Ent638_4125 |
Erwinia amylovora ATCC 49946 | ||||
Position: -264
Score: 4.38819 Sequence: ATTTGTGATCGTGGACACGCTT
Locus tag: EAM_3481
Name: atpI Funciton: ATP synthase subunit I
Locus tag: EAM_3480
Name: atpB Funciton: ATP synthase subunit A
Locus tag: EAM_3479
Name: atpE Funciton: ATP synthase subunit C
Locus tag: EAM_3478
Name: atpF Funciton: ATP synthase subunit B
Locus tag: EAM_3477
Name: atpH Funciton: ATP synthase subunit D
Locus tag: EAM_3476
Name: atpA Funciton: ATP synthase subunit A
Locus tag: EAM_3475
Name: atpG Funciton: ATP synthase subunit C
Locus tag: EAM_3474
Name: atpD Funciton: ATP synthase subunit B
Locus tag: EAM_3473
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -264 | 4.4 | ATTTGTGATCGTGGACACGCTT | EAM_3481 |
Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
Position: -254
Score: 5.00697 Sequence: TTATGTGAGTCACATCACAGAT
Locus tag: ECA4519
Name: atpI Funciton: ATP synthase subunit I
Locus tag: ECA4518
Name: atpB Funciton: ATP synthase subunit A
Locus tag: ECA4517
Name: atpE Funciton: ATP synthase subunit C
Locus tag: ECA4516
Name: atpF Funciton: ATP synthase subunit B
Locus tag: ECA4515
Name: atpH Funciton: ATP synthase subunit D
Locus tag: ECA4514
Name: atpA Funciton: ATP synthase subunit A
Locus tag: ECA4513
Name: atpG Funciton: ATP synthase subunit C
Locus tag: ECA4512
Name: atpD Funciton: ATP synthase subunit B
Locus tag: ECA4511
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -254 | 5 | TTATGTGAGTCACATCACAGAT | ECA4519 |
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -263
Score: 4.79693 Sequence: ATATGTGATCTGAAGCACGCTT
Locus tag: b3739
Name: atpI Funciton: ATP synthase subunit I
Locus tag: b3738
Name: atpB Funciton: ATP synthase subunit A
Locus tag: b3737
Name: atpE Funciton: ATP synthase subunit C
Locus tag: b3736
Name: atpF Funciton: ATP synthase subunit B
Locus tag: b3735
Name: atpH Funciton: ATP synthase subunit D
Locus tag: b3734
Name: atpA Funciton: ATP synthase subunit A
Locus tag: b3733
Name: atpG Funciton: ATP synthase subunit C
Locus tag: b3732
Name: atpD Funciton: ATP synthase subunit B
Locus tag: b3731
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -263 | 4.8 | ATATGTGATCTGAAGCACGCTT | b3739 |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
Position: -262
Score: 4.74828 Sequence: TTATGTGATCTGATGCACGCTT
Locus tag: KPN_04144
Name: atpI Funciton: ATP synthase subunit I
Locus tag: KPN_04143
Name: atpB Funciton: ATP synthase subunit A
Locus tag: KPN_04142
Name: atpE Funciton: ATP synthase subunit C
Locus tag: KPN_04141
Name: atpF Funciton: ATP synthase subunit B
Locus tag: KPN_04140
Name: atpH Funciton: ATP synthase subunit D
Locus tag: KPN_04139
Name: atpA Funciton: ATP synthase subunit A
Locus tag: KPN_04138
Name: atpG Funciton: ATP synthase subunit C
Locus tag: KPN_04137
Name: atpD Funciton: ATP synthase subunit B
Locus tag: KPN_04136
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -262 | 4.7 | TTATGTGATCTGATGCACGCTT | KPN_04144 |
Photorhabdus luminescens subsp. laumondii TTO1 | ||||
Position: -265
Score: 5.72401 Sequence: TTATGTGATTTAAATCACATTT
Locus tag: plu0047
Name: atpI Funciton: ATP synthase subunit I
Locus tag: plu0046
Name: atpB Funciton: ATP synthase subunit A
Locus tag: plu0045
Name: atpE Funciton: ATP synthase subunit C
Locus tag: plu0044
Name: atpF Funciton: ATP synthase subunit B
Locus tag: plu0043
Name: atpH Funciton: ATP synthase subunit D
Locus tag: plu0042
Name: atpA Funciton: ATP synthase subunit A
Locus tag: plu0041
Name: atpG Funciton: ATP synthase subunit C
Locus tag: plu0040
Name: atpD Funciton: ATP synthase subunit B
Locus tag: plu0039
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -265 | 5.7 | TTATGTGATTTAAATCACATTT | plu0047 |
Proteus mirabilis HI4320 | ||||
Position: -259
Score: 5.04378 Sequence: TTGTGTGTTCTAGATCACATTA
Locus tag: PMI3057
Name: atpI Funciton: ATP synthase subunit I
Locus tag: PMI3058
Name: atpB Funciton: ATP synthase subunit A
Locus tag: PMI3059
Name: atpE Funciton: ATP synthase subunit C
Locus tag: PMI3060
Name: atpF Funciton: ATP synthase subunit B
Locus tag: PMI3061
Name: atpH Funciton: ATP synthase subunit D
Locus tag: PMI3062
Name: atpA Funciton: ATP synthase subunit A
Locus tag: PMI3063
Name: atpG Funciton: ATP synthase subunit C
Locus tag: PMI3064
Name: atpD Funciton: ATP synthase subunit B
Locus tag: PMI3065
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -259 | 5 | TTGTGTGTTCTAGATCACATTA | PMI3057 |
Salmonella typhimurium LT2 | ||||
Position: -262
Score: 4.64922 Sequence: ATGTGTGATCTGGTGCACGCTT
Position: -211
Score: 4.05602 Sequence: TTTTGTACGATCGTTCACACTT
Locus tag: STM3872
Name: atpI Funciton: ATP synthase subunit I
Locus tag: STM3871
Name: atpB Funciton: ATP synthase subunit A
Locus tag: STM3870
Name: atpE Funciton: ATP synthase subunit C
Locus tag: STM3869
Name: atpF Funciton: ATP synthase subunit B
Locus tag: STM3868
Name: atpH Funciton: ATP synthase subunit D
Locus tag: STM3867
Name: atpA Funciton: ATP synthase subunit A
Locus tag: STM3866
Name: atpG Funciton: ATP synthase subunit C
Locus tag: STM3865
Name: atpD Funciton: ATP synthase subunit B
Locus tag: STM3864
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -262 | 4.6 | ATGTGTGATCTGGTGCACGCTT | STM3872 |
-211 | 4.1 | TTTTGTACGATCGTTCACACTT | ||
Serratia proteamaculans 568 | ||||
Position: -265
Score: 4.38999 Sequence: TATTGTGAGCAACTACACGTTT
Locus tag: Spro_0001
Name: atpI Funciton: ATP synthase subunit I
Locus tag: Spro_0002
Name: atpB Funciton: ATP synthase subunit A
Locus tag: Spro_0003
Name: atpE Funciton: ATP synthase subunit C
Locus tag: Spro_0004
Name: atpF Funciton: ATP synthase subunit B
Locus tag: Spro_0005
Name: atpH Funciton: ATP synthase subunit D
Locus tag: Spro_0006
Name: atpA Funciton: ATP synthase subunit A
Locus tag: Spro_0007
Name: atpG Funciton: ATP synthase subunit C
Locus tag: Spro_0008
Name: atpD Funciton: ATP synthase subunit B
Locus tag: Spro_0009
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -265 | 4.4 | TATTGTGAGCAACTACACGTTT | Spro_0001 |
Yersinia pestis KIM | ||||
Position: -263
Score: 5.42488 Sequence: TTATGTGATGTATTTCACGTTT
Locus tag: y4142
Name: atpI Funciton: ATP synthase subunit I
Locus tag: y4141
Name: atpB Funciton: ATP synthase subunit A
Locus tag: y4140
Name: atpE Funciton: ATP synthase subunit C
Locus tag: y4139
Name: atpF Funciton: ATP synthase subunit B
Locus tag: y4138
Name: atpH Funciton: ATP synthase subunit D
Locus tag: y4137
Name: atpA Funciton: ATP synthase subunit A
Locus tag: y4136
Name: atpG Funciton: ATP synthase subunit C
Locus tag: y4135
Name: atpD Funciton: ATP synthase subunit B
Locus tag: y4134
Name: atpC Funciton: ATP synthase epsilon subunit |
||||
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC | -263 | 5.4 | TTATGTGATGTATTTCACGTTT | y4142 |